Basic Local Alignment Search Tool (Lab 4) J_Armstrong
.docx
keyboard_arrow_up
School
Medaille College *
*We aren’t endorsed by this school
Course
MISC
Subject
Biology
Date
Feb 20, 2024
Type
docx
Pages
29
Uploaded by MegaThunderJackal10 on coursehero.com
Joe Armstrong
BIO 616
LAB 4
Use your sequences of gene/protein of interest.
Using BLAST: NCBI web site, https://www.ncbi.nlm.nih.gov/ NCBI BLAST, https://blast.ncbi.nlm.nih.gov/Blast.cgi
Run blastn and blastp with default parameters but limit ‘Max target sequences’ to 20.
-I searched “
QDS03030.1
” in blastn & blastp; however, “max target sequences to 20
” was not available, so I selected “max target sequence length 10”. I kept all other parameters the same as requested. Unfortunately, my accession # was for protein and not nucleotides, so my blastn produced the following result:
My blastp found the following:
And:
Joe Armstrong
BIO 616
And:
Joe Armstrong
BIO 616
And:
The taxonomy and lineage is important for my research interest and identifications and comparisons.
Joe Armstrong
BIO 616
I updated my blastn search with query: “MH687451.1”, the nucleotide analogue for my previous protein query. I got the following results:
And:
And:
Joe Armstrong
BIO 616
And:
Joe Armstrong
BIO 616
Try different parameters (e.g., different matrices) and record outcomes and differences in between outcomes – record the effects on score, the number of gaps, the present identity, and the length of the aligned region.
I altered the following in blastp:
And:
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
- Access to all documents
- Unlimited textbook solutions
- 24/7 expert homework help
Related Questions
The accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)
arrow_forward
Primer pairs of homo sapiens isolate breast cancer brca1 gene.
Select the best primer pair then give 5 reasons why is it the best
arrow_forward
In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence?
5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’
5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’
5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’
5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’
5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
arrow_forward
in your word, identify one difference one similarity between 16 S sequencing and metagenomic shotgun sequencing
arrow_forward
Please answer fast
Using the cDNA copies of the transcripts from parasite-cells infected with red fluorescence, and cDNA copies of the transcripts from normal cells labeled with with green fluorescence, what color would you predict the well with the ninjurin gene would
appear on the microarray?
a-gray
b-green
c-red
d-yellow
arrow_forward
Give only typing answer with explanation and conclusion
Information:
1_Green Fluorescent Protein
2_nucleotide sequence, Amino acid sequence, and primers are obtained.
3_PCR protocol already described
4_bp has been calculations and estimated agarose gel image already designed.
Questions:
How do you analyze whether your target protein is expressed by E. coli cells. Explain your analysis method in detail and give information about the results you expect (in detail please)
arrow_forward
Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in Lee’s cancer) from a complex mixture of genomic DNA. Remember that the entire human genome sequence is known. (Hint: This is a technique that is commonly used by laboratories that do genetic testing and various other applications of molecular biology.)
arrow_forward
1) Enhanced GFP protein has:
An excitation peak at 488nm and emits maximally at 507nm.
An excitation peak at 488nm and emits maximally at 587nm
An excitation peak at 488nm and emits maximally at 567nm.
An excitation peak at 458nm and emits maximally at 507nm.
2)
A typical sequencing read will yield _____ nucleotides of unambiguous sequence.
1800-2000
3800-4000
2800-3000
800-1000
3)
Sequencing primers should be designed to bind where?
~ 25 nucleotides upstream of the beginning region to be sequenced.
~ 25 nucleotides downstream of the beginning region to be sequenced
~ 60 nucleotides upstream of the beginning region to be sequenced.
~ 60 nucleotides downstream of the beginning region to be sequenced
arrow_forward
28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5'
a) 3' AATTTGGGGC*
( b) 3' ATGCTTTTTT* ( )
c) 5' TTTAAAGGG* 19 ( )
d) 5' ATGCTTTTTT* )
e) a and b ()
f) a and d 23
g) b and d
29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen.
() True
False
30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below.
a) The SD sequence 3' AGGAGGU is stronger than…
arrow_forward
LO 64- Explain how Next gen sequencing is applied in different technologies
In which of the following scenario would it be best to use Next-gen sequencing? (select all that apply)
a-To separate fragments of DNA based on their size-
b-To insert a mutation at random in a gene
c-To idently a novel pathogen
d-To determine the nucleotide sequence of a microbe
e- To insert methyl groups to cytosines in a DNA sequence
asap please
arrow_forward
Select all the statements that provide evidence that DNA is the genetic material.
Check All That Apply
1. By weight, a eukaryotic chromosome contains more protein than DNA.
2. Treatment of purified DNA with a DNA-degrading enzyme destroyed the ability of S bacteria to transform R bacteria.
3. The R mutant form of S. pneumonia does not cause infection in mice.
4. Radioactively-labeled DNA remained in bacterial cells after phage T2 infection.
5. Proteins are more complex than DNA because they are composed of 20 different amino acids.
Pls help asap!! I am so confused
arrow_forward
summarize these results using concise language in a neat table;
Control :
5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’
This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence.
So the mRNA sequence is :
5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’
Mutant 1:
5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’
mRNA sequence
5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’
The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence.
Mutant 2:
5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’
mRNA sequence:
5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’
In this mutation, Cytosine is replace by Thymine and hence the codon…
arrow_forward
A plaque assay is performed beginning with 1 mL of a solution containing bacteriophages. This solution is serially diluted 4 times by combining 0.1 mL of each sequential dilution with 9.9 mL of liquid medium. Then 0.1 mL of the final dilution is plated in the plaque assay and yields 21 plaques. What is the initial density of bacteriophages in the original 1 mL? Recall that initial phage density = (plaque number/mL) ×× (dilution factor).
arrow_forward
In the "Bacterial Transformation" experiment, why were there no fluorescence bacteria present in the other plates even though these were inserted by the +pGLO plasmid? (Note: Discuss the importance on the addition of ampicillin and arabinose to the medium of the genetically engineered bacteria). Limit your answer to 1-3 sentences only.
arrow_forward
#2 EcoRI --- 5’ G ↓AATTC 3’
5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’
3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’
Restriction enzyme:
Recognition sequence:
Number of pieces of DNA:
Type of cut:
arrow_forward
MULTIPLE CHOICE Read the questions below carefully. There is only one correct answer for each question.
1. In a DNA sample of Escherichia coli (a bacteria), 23.6% of the nitrogenous bases are thymine. What percentage of cytosine nitrogen bases is present in this sample?
a) 76.4%
b) 23.6%
c)26.4%
d) 52.8%
2. If the adenine is located on the Z strand as shown (see attachement 3) , then on the W strand, in the same place, we should find:
a) Uracil
b) Adenine
c) Thymine
d)Cytosine
3. Which of these deletions best represents a chromosomal deletion? (see options in attachment 3)
4. It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is another nucleic acid alongside RNA: DNA. What role does the latter play in relation to RNA?
a) RNA is synthesized in the cell in case too large a mutation damages the DNA.
b) DNA has the reproductive genetic code of all cells and passes it on to RNA.
c) DNA directs the synthesis of enzymes, while RNA synthesizes…
arrow_forward
To achieve a 10x depth coverage for a genome of length 10 Mbp, how many reads of 100 bp are required?
a) 1 million
b) 5,000
c) 100,000
d) 50,000
arrow_forward
Sanger DNA sequencing/ dideoxy sequencing was used as shown in the diagram below. The arrow indicates the direction for migration of the bands in the gel. What are the first 3 letters of this DNA sequence?
arrow_forward
TALENs
What is it?
And how it works in genome editing?
Including additional figures pls
At least 1-2 page
arrow_forward
Give typed full explanation
you made a recombinant plasmid (it is circular) that contains the sequence 5' AAGCTT in the middle of the inserted or cloned gene. that is the only place where this sequence occurs. the entire plasmif does not have 5' GAATTC. When putting this plasmid into E. coli (transformstion) what will happen?
1. plasmid will cut into several fragments
2. nothing the plasmif with remain circular
3. plasmid will be cut once making a linear dna fragment
4. will be cut once but will becomr two linear fragments
arrow_forward
Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment.
(1) DNA sequencing
(2) Allow for hybridization and wash excess cRNA.
(3) Mix labeled cRNA with array chip.
(4) PCR amplification
(5) Measure fluorescence intensity to determine abundance of transcripts.
(6) Add labeled cRNA at each microarray location.
(7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts.
(8) mRNA isolation from cells
(9) Prepare fluorescently labeled cRNA probes
(10) cDNA synthesis
arrow_forward
describe each step carefully and use your own words. Steps will be like following;
I) Primer design for SLIC cloning and the protocol
II) Transformation and sequence validation of the clones
III) Culture of HEK293T
IV) Transduction of HEK293T cells with plasmid
V) Western Blotting
VI) Immunfluorescence for Confocal Microscopy
arrow_forward
NEED ASAP Using the list provided (note you may not need all the steps listed) state the steps in cDNA production
1. Confirm size of bands by comparing to molecular size marker.
2. Ligate oligonucleotides onto blunt ended product.
3. Cut the cDNA with a unique restriction enzyme.
4. Ligate the cDNA and vector followed by transformation of E. coli.
5. Plate cells onto LB-ampicillin plates containing X-gal.
6. Choose colonies that are white in colour.
7. Cut plasmid with unique restriction enzymes.
8. The size of the clone is small and it will ensure that the entire gene will be
found in one fragment.
9. Employ replica plating technique and select cells that are ampicillin-sensitive
and tetracycline resistant.
10. Blot petri plates with a nitrocellulose filter, lyse the cells and denature the DNA
with a dilute sodium hydroxide solution.
11. Blot electrophoresis gel with nitrocellulose filter and denature the DNA with a
dilute sodium hydroxide solution.
12. Flood the filters with…
arrow_forward
Ehat primer sets could be amplify the following DNA sequence?
AATACGTCGCATGGggatccttttttatgcatg
arrow_forward
https://drive.google.com/file/d/1fOtSuZ_NNdi7qRXHCkM6mtvwRS0pl8u6/view?usp=sharing
Compute the [A + C]/[T or U] +G] ratios of the DNA and RNA models in Figure 1. Do you expect the same values for other DNA and RNA models that will be constructed for instance? Why?
arrow_forward
Give a major disadvantage of RAPD as a DNA marker. Provide one (1) recommendation onhow to address this limitation. Briefly discuss. (in 5 sentences only)
arrow_forward
Below is a sequence of DNA.
5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3'
How many "reading frames" can be identified for this sequence?
How many "open reading frames" can be identified for this sequence?
What is the frame of the longest ORF?
arrow_forward
Redraw Figure 10-6 with the goal of adding one EcoRIend and one XhoI end. Below is the Xhol recognitionsequence.Recognition sequence:. . . CTCGAG . . .. . . GAGCTC . . .After cut:. . . C TCGAG . . .. . . GAGCT C . . .
arrow_forward
Given below is the DNA template. What are the gene products?
3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’
5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’
arrow_forward
please help me with thi question.
What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA?
The options are attached. Multiple answers can be chosen
arrow_forward
Download BLOSUM30 and BLOSUMB0 substitu- tion matrices and place them side by side on your computer screen. What are the differences between the two matrices? Why do you see these differences?
arrow_forward
Please help me answer topic is about making a recombinant DNA model
arrow_forward
. The website CBioPortal (http://www.cbioportal.org)is an exceptionally useful program for visualizing thecancer genes and genomes of tumors from thousandsof patients with different kinds of cancer that havebeen analyzed by whole genome sequencing and insome cases, by RNA-Seq.Go the the CBioPortal site and click All underSelect Cancer Study and in Enter Gene Set typePTEN, then hit Submit. On the page that is returnedyou will see how the coding region of the PTEN geneis altered in tumors investigated in the various studies.Hitting the tab Mutations will let you see the detailsof these mutations relative to the PTEN protein, whilethe tab Expression lets you see how the gene’s expression (in terms of cDNA reads) is altered in individual tumor samples.a. Is PTEN an oncogene or a tumor suppressor gene?What kinds of evidence lead you to this conclusion?b. What kinds of cancer are most likely to involvealterations of PTEN?c. How would you identify patients whose tumorcells are particularly…
arrow_forward
ZFNs
What is it?
And how it works in genome editing?
Including additional figures pls
At least 1-2 page
arrow_forward
5. A haplotype is a specific set of SNPs and other genetic variants observed on a single chromosome or part of a chromosome, as compared between individuals in a population. Shown below are eight DNA sequences from different individuals: Nucleotide Position 1 5 10 15 Sequence 1. TCTGGAT CAT CACAT Sequence 2. ACAGCAT CATIA CGT Sequence 3. TCAGGAT CATIA CAT. Sequence 4. TCAGGAT CATI A CAT. Sequence 5. ACAGCATCATI ACGT Sequence 6. TCT G GAT CAT CACAT Sequence 7. TCAGGAT CATI A CAT. Luis Pagoada Sequence 8. ACAGCAT CAT IACGT. a. Give the nucleotide positions of all single nucleotide polymorphisms (SNPs; nucleotide positions where individuals vary in which base is present) in these sequences. b. How many different haplotypes (sets of linked variants) are found in these eight sequences?
arrow_forward
Go to the NCBI’s website at https://ncbi.nlm.nih.gov On the database dropdown menu, select “Gene” and search for “RB1.” The first entry should be on the Homo sapiens version; click the gene name. Use the information to answer the following:
Return to the RefSeq section in the Gene Database for RB1 (back click once from where you were for part c). Click on the link under “mRNA and Protein(s)” listed as NM_000321.3. This will take you to the mature mRNA sequence data:
a. How many bases long is the full-length RB1 mRNA transcript?
b. Scroll down to “Features.” Click on “CDS.” This will highlight the coding sequence region of the RB1 mRNA. This is the sequence that will be translated into a protein.
At what positions (numbers) does the coding sequence start and stop?
How long is the coding sequence?
How many amino acids should this encode for? (HINT: does the stop codon encode an amino acid?)
arrow_forward
Go to the NCBI’s website at https://ncbi.nlm.nih.gov On the database dropdown menu, select “Gene” and search for “RB1.” The first entry should be on the Homo sapiens version; click the gene name. Use the information to answer the following:
Return to the RefSeq section in the Gene Database for RB1 (back click once from where you were for part c). Click on the link under “mRNA and Protein(s)” listed as NM_000321.3. This will take you to the mature mRNA sequence data:
a. Scroll back up to “Features.” As you are scrolling, count the number of “exon” links there are.
What is an exon?
How many exons make up the RB1 transcript?
b. As you scroll through the “Features” list, observe some of the miscellaneous features (“misc_feature”) of the transcript. These are examples of annotations, which give more information about the sequence than just the order of bases. For example, “misc_feature 916…918” is a “phosphothreonine, by CDK1.” What information can you interpret from this annotation?…
arrow_forward
SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Related Questions
- The accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)arrow_forwardPrimer pairs of homo sapiens isolate breast cancer brca1 gene. Select the best primer pair then give 5 reasons why is it the bestarrow_forwardIn a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’arrow_forward
- in your word, identify one difference one similarity between 16 S sequencing and metagenomic shotgun sequencingarrow_forwardPlease answer fast Using the cDNA copies of the transcripts from parasite-cells infected with red fluorescence, and cDNA copies of the transcripts from normal cells labeled with with green fluorescence, what color would you predict the well with the ninjurin gene would appear on the microarray? a-gray b-green c-red d-yellowarrow_forwardGive only typing answer with explanation and conclusion Information: 1_Green Fluorescent Protein 2_nucleotide sequence, Amino acid sequence, and primers are obtained. 3_PCR protocol already described 4_bp has been calculations and estimated agarose gel image already designed. Questions: How do you analyze whether your target protein is expressed by E. coli cells. Explain your analysis method in detail and give information about the results you expect (in detail please)arrow_forward
- Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in Lee’s cancer) from a complex mixture of genomic DNA. Remember that the entire human genome sequence is known. (Hint: This is a technique that is commonly used by laboratories that do genetic testing and various other applications of molecular biology.)arrow_forward1) Enhanced GFP protein has: An excitation peak at 488nm and emits maximally at 507nm. An excitation peak at 488nm and emits maximally at 587nm An excitation peak at 488nm and emits maximally at 567nm. An excitation peak at 458nm and emits maximally at 507nm. 2) A typical sequencing read will yield _____ nucleotides of unambiguous sequence. 1800-2000 3800-4000 2800-3000 800-1000 3) Sequencing primers should be designed to bind where? ~ 25 nucleotides upstream of the beginning region to be sequenced. ~ 25 nucleotides downstream of the beginning region to be sequenced ~ 60 nucleotides upstream of the beginning region to be sequenced. ~ 60 nucleotides downstream of the beginning region to be sequencedarrow_forward28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than…arrow_forward
- LO 64- Explain how Next gen sequencing is applied in different technologies In which of the following scenario would it be best to use Next-gen sequencing? (select all that apply) a-To separate fragments of DNA based on their size- b-To insert a mutation at random in a gene c-To idently a novel pathogen d-To determine the nucleotide sequence of a microbe e- To insert methyl groups to cytosines in a DNA sequence asap pleasearrow_forwardSelect all the statements that provide evidence that DNA is the genetic material. Check All That Apply 1. By weight, a eukaryotic chromosome contains more protein than DNA. 2. Treatment of purified DNA with a DNA-degrading enzyme destroyed the ability of S bacteria to transform R bacteria. 3. The R mutant form of S. pneumonia does not cause infection in mice. 4. Radioactively-labeled DNA remained in bacterial cells after phage T2 infection. 5. Proteins are more complex than DNA because they are composed of 20 different amino acids. Pls help asap!! I am so confusedarrow_forwardsummarize these results using concise language in a neat table; Control : 5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence. So the mRNA sequence is : 5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ Mutant 1: 5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence 5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence. Mutant 2: 5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence: 5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ In this mutation, Cytosine is replace by Thymine and hence the codon…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education