Solve it asap 10. Messenger RNA often encodes more that one biological activity. These activities can thenbe selectively released by specific proteases that often recognize:A. disulfide bridges.B. basic amino acid pairs.C. stop codons. ID. proline-glycine-hydroxyproline sequences.E. formxlated methionine.

Introduction: Messenger RNA (mRNA) is a single-stranded RNA that carries hereditary information from…

Answered: 10. Messenger RNA often encodes more…

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 14QP: In the gene-coding sequence shown here, which of the following events will produce a frameshift...

See similar textbooks

Similar questions

1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
Which of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water Photophosphorylation
The aminoacyl-tRNA synthetase enzymes are responsible for: O A. matching each tRNA with the appropriate mRNA codon. O B. catalyzing the enzymatic step of peptide bond formation during translation. O C. synthesizing tRNA molecules in the nucleus from tRNA genes. O D. adding amino acids to appropriate tRNAS (charging the tRNA). O E. regulating the process of amino acid synthesis.
1. Identify the term being asked by the statement: a. It describes mRNA that results in a single translation of several genes at a time. b. It guides the newly formed polypeptide/protein to the endoplasmic reticulum for further processing c. These are Nucleotide sequences resulting in stem loop structures in the mRNA , and subsequent falling off of the RNA polymerase from the mRNA strand. d. It is a A secondary structure in proteins where the amino acid chains aligned side-by-side with every other chain situated opposite the other, with chains being held together by hydrogen bonds
1. TRUE OR FALSE a) Eukaryotic mRNA contains the message from the DNA for the synthesis of one polypeptide. b) The 2'OH in the sugars of RNA is advantageous to the molecule to facilitate its hydrolysis
All of the following apply to tRNAs EXCEPT: (more than one may apply) A. attach amino acids at the 5’ end B. have stems and loops C. are all encoded by a single gene D. an anti-codon of 5’AAC3’ corresponds to a codon of 3’UUG5’ E. exhibit distinctive 3D folds F. are acted on by 64 different aminoacyl synthetases G. are charged with amino acids by peptidyl transferase
The degeneracy of the Genetic code is due to A. a 1 to 1 correlation between single amino acids and single nucleotides B. The fact that tRNAs can bind to mRNAs at the same time they transfer amino acids to a growing polypeptide chain C. The fact that there is only one start codon D. The fact that the code is non-overlapping E. The fact that more than one codon specifying an amino acid F. None of the above
1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)
2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT CCA CAG ACA * AGU AAA GGU GUc UGU 3. Translate the mRNA codons (i.e. your answer to question 2) into the appropriate amino acids using the following Universal Genetic Code Chart. * Universal Genetic Code Chart Messenger RNA Codons and the Amino Acids for Which They Code SECOND BASE A UCU UAU UGU UUU UUC UUA PHE TYR CYS UCC UCA UAC UGC SER UAA UGA STOP LEU STOP UUG UGG} TRP UCG UAG CUU CCU CAU CGU HIS CUC CCC CAC CGC LEU PRO ARG CCA CCG CUA CAA CGA GLN CUG CAG CG AUU AUC ACU AAU AGU AGC AGA ASN SER ILE ACC AAC THR AAA AAGS ACA AUA AUG MET or START LYS ARG ACG AGG S GCU GCC GUU GAU GGU ASP GUC GAC GGC VAL ALA GLY GUA GCA GCG GAA GGA GGG GLU GUG GAG トエーCロ ASE A, L-RST BASE
1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC S' a. What amino acids are coded by this sequence? b. An adenine is inserted in this strand after the first guanine from the left. The resulting polypeptide is six amino acids long. Where is the newly produced nonsense codon located? What is the amino acid sequence in the fragment?
1. True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be transported to the endoplasmic reticulum b. In the ribosome during translation, the incoming tRNA will transfer its amino acid to the outgoing tRNA c.Folding of nascent or new proteins occurs after the full-length polypeptide chain has been separated from the ribosome after translation d. A signal peptide may or may not be degraded once it has guided the polypeptide to the endoplasmic reticulum
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

10. Messenger RNA often encodes more that one biological activity. These activities can then be selectively released by specific proteases that often recognize: A. disulfide bridges. B. basic amino acid pairs. C. stop codons. I D. proline-glycine-hydroxyproline sequences. E. formxlated methionine.