19. Endorphins are polypeptides that reduce pain. What is the amino acid order for the following mRNA, which codes for a pentapeptide that is an endorphin called leu- enkephalin? 5'AUG UAC |GGU | GGA UUU | CUA | UAA3'
Q: Two of the key carbonic anhydrases are in the muscles and in the lungs. What would you expect the…
A: The major difference between the carbonic anhydrases in muscles and lungs lies in their respective…
Q: Glycolysis is the process by which energy is harvested from glucose by living things. Several of the…
A: Consider 2 reactions; reaction T and reaction V. Suppose reaction T has a value of 'x' and reaction…
Q: Question 1. What is the O₂ saturation in the lungs? 2. What is the O₂ saturation in tissues at rest?…
A: We can find the O2 saturation % of hemoglobin at various conditions in various organs of the body…
Q: Which of the following vitamins do you expect to enter the cell via diffusion (i.e., NOT need a…
A: Diffusion refers to the movement of a substance from a region of higher concentration to a region of…
Q: Crocodiles can use virtually 100% of the oxygen in its blood, whereas humans can extract only about…
A: Let's evaluate each statement to determine which one best explains why HCO3 in the crocodile works…
Q: The following is [Select] [Select] CH OH OH OH OH V glycosidic bond. CH₂OH О OH ОН disaccharide with…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula:…
Q: Provide a reasonable step-wise mechanism for the reaction below, involving TPP as a coenzyme (can…
A: Enzyme catalysis can occur via different mechanisms such as general acid/base catalysis, covalent…
Q: 1. Make a Lineweaver-Burk plot and use the plot to complete the information in the table and the…
A: Enzyme kinetics:The study of the reaction rates of enzyme catalyzed reactions. Initial reaction rate…
Q: Which of the following statements describes one reason that plant oils are generally healthier for…
A: Plant oils are liquid fats extracted from various plant sources, such as seeds, nuts, and fruits.…
Q: Consider the Haworth projections of B-L-galactose and B-L-glucose shown here. ОН ОН CH OH ОН ОН…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula:…
Q: Positive results for Benedict’s test range from green, yellow orange to red. How does the sugar…
A: There are 4 classes of biological macromolecules: nucleic acid, proteins, lipids and…
Q: The urea cycle can be summarized through the following reaction: O COO- || H₂N-C-OPO3 +…
A:
Q: Draw a representation of an allosteric binding site of an enzyme. The allosteric site must bind an…
A:
Q: 2. ( Labeling molecules with isotopes has long been used to trace and characterize metabolic…
A:
Q: Glucagon is a hormone that is released when the level of glucose in the blood is low. Glucagon uses…
A: Glucagon is secreted by the α cells of pancreas.Glucagon is a hormone that helps to regulate blood…
Q: Match each of the following aspects of triacylglycerols (TAGs) with the main structural feature…
A: There are four classes of biological macromolecules - they are nucleic acid, proteins, lipids and…
Q: The TCA cycle enzyme aconitase and the electron transport proteins have chromophores that absorb in…
A: Electron Transport Proteins are molecules that assist in transferring electrons from electron donors…
Q: Calculate the change in Gibbs free energy for transport of Ca2+ from outside to inside the cell. The…
A: Free energy change (ΔG) of uncharged solute transport across a biological membrane can be calculated…
Q: Which of these amino acids is NOT a common attachment point for sugars in glycoproteins? A) Gly…
A: The proteins that contain the covalently attached oligosaccharide chains to the amino acid residues…
Q: 1. Start with the Michaelis-Menten equation and convert it to a double-reciprocal equation. Show how…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: The purified OXA-M290 enzyme can now be tested to determine which β-lactamase inhibitor is most…
A: Beer Lambert's equation relates the concentration of the analyte to the absorbance value recorded by…
Q: 1. Cyanide, oligomycin, and 2,4-dinitrophenol are all inhibitors of oxidative phosphorylation in…
A: ETC consists of four protein complexes called Complex I, II, III and IV that transport electrons…
Q: We humans do not express an alpha-Galactosidase enzyme and therefore cannot break down stachyose but…
A: Stachyose is a tetrasaccharide made up of two , one and one . Stachyose can be represented as .Gal…
Q: Question 4. Imagine the main chain of a protein bends back on itself so that two amino acid residues…
A: There are four classes of biological macromolecules: proteins, nucleic acid, lipids and…
Q: The enzyme aldolase catalyzes the reaction shown in the glycolytic pathway: Aldolase Fructose…
A: The ratio of concentration of products to reactants for any reaction in a given condition at…
Q: What is the effect of type 2 diabetes (T2D) on pentose phosphate pathway (PPP) flux? T2D facilitates…
A: In type 2 diabetes, the cells do not respond normally to insulin. The body develops what is known as…
Q: 9. What are the primary differences between site-specific recombination and general recombination?…
A: Recombination is the process of reshuffling genetic material to create new combinations of genes…
Q: "de 96 5 no
A: Answer :- The pH of the solution and the pKa values of the side chains of amino acids must be taken…
Q: 1) The approximate length of a DNA double helix is around 0.34nm per base pair. If the extracted D…
A: 1) A somatic human cell has 23 pairs of chromosomes, that is 46 pieces of DNA. The combined length…
Q: Membrane lipids in tissue
A: Membrane lipids:These are an important component of cell membranes.These surround and enclose cells…
Q: sucrose
A: Sucrose:It is a disaccharide that consists of 2 monosaccharide units i.e., glucose and…
Q: Why might the compound below be a potent transition state analog inhibitor for isocitrate…
A: Transition states are short-lived species that arise as a substrate is being converted to a product…
Q: Out of starch, glycogen, cellulose and chitin, carbohydrate polymers with beta linkages are O…
A: The alpha and beta linkages are types of glycosidic linkages which are formed between the hemiacetal…
Q: A contributing factor to the development of arthritis is the inappropriate proteolytic destruction…
A: A variable is any quantity we can measure. In any experiment there are three variables: Independent:…
Q: For the following reaction mechanism, which of the following statements would be false? R" R :B NO R…
A: Enzymes are proteins that catalyze biochemical reactions. Some enzymes require non non-protein…
Q: select the false statement regarding phospholipid bilayer membranes. phospholipid bilayer part…
A: A cell is made up of different biomolecules. Biomolecules are of four types: carbohydrates,…
Q: Which of the following is characteristic of competitive inhibitors? the inhibitor could bind to the…
A: Inhibitors can be broadly classified into reversible and irreversible inhibitors. Reversible…
Q: A 25-year-old man has a lifelong hemorrhagic diathesis. The PT and bleeding time are normal, but the…
A: Hemorrhagic diathesis is a condition characterized by a tendency to bleed excessively or for an…
Q: Which of the outcomes could potentially result if a mutation in the gene encoding the Ga subunit…
A: Heterotrimeric G protein is a complex comprised of 3 protein subunits;, and . They are often…
Q: (i) During the Pyruvate Decarboxylase (PDC) catalysed reaction, a covalent coenzyme intermediate is…
A: Pyruvate Decarboxylase (PDC) catalyzes the decarboxylation of pyruvate to produce acetaldehyde and…
Q: Which of the following statements are true regarding the Bohr effect? It involves a decrease in…
A: The Bohr effect is a physiological phenomenon first described by the Danish physiologist Christian…
Q: Fructose is a labeled on its anomeric carbon with 14C. This labeled fructose is added to muscle…
A: A method utilized in many scientific investigations including radiocarbon dating is carbon-14 (C-14)…
Q: How many different reactions (enzymes) in the glycolytic pathway (steps 1 - 10) involve ATP either…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 2 molecules of…
Q: Proto-oncogenes are genes that have the potential to become oncogenes through either mutation or an…
A: Genes are the segments of DNA that code for proteins. These are passed from parents to offspring. A…
Q: The C-2 epimer of A is [Select] [Select] H- Н- НО Н- -H CHO OH OH Н H OH НО НО OH -H -H Н- Н- CHO B…
A: Carbohydrates are polyhydroxy aldehydes or ketones. Monosaccharides are simplest carbohydrates:…
Q: Describe why hydrogen, carbon, nitrogen, and oxygen can be considered the most important building…
A: A cell is the basic unit of life. Cells are made up of biomolecules like carbohydrate, proteins,…
Q: We did an experiment about carbohydrate chemistry and the prof did not elaborate on the details. She…
A: Carbohydrates are abundantly found in the plants.In animals they are found in storage form such as…
Q: Alcohol dehydrogenase catalyzes the oxidation of an alcohol to the next highest state of oxidation,…
A: The question is asking us to explain how the enzymatic activity of alcohol dehydrogenase, which…
Q: 15. Write the metabolites of the following substrates due to phase Il reactions: a. b, R R C. R R NH…
A: Enzymes are proteins that catalyze biochemical reactions. Enzymes sometimes require a non-protein…
Q: Individuals with a thiamine-deficient diet have relatively high levels of pyruvate in their blood.…
A: The diseases that occur because of insufficient intake of essential nutrients are called deficiency…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine6. How many amino acids will the mRNA sequence "AUG GÁC CUG UCG UGA" produce? (LS1-1) * Second mRNA base G UUU Phe UUC UCU UAU UGU Tyr UAC Cys UCC Ser UCA UGC C Phe Gly (G) Leu UAA Stop UGA Stop A Glu (F) (L) UUA Leu UUG Ser Asp (E) (D) (S) Tyr (Y) UCG UAG Stop UGG Trp GUC Ala CUU (A) A CCU CAU CGU His CUC Leu CUA CC Pro ССА CAC CGC Arg CGA Cys (C) Val CAA Gln CAG G U (V) G Trp (W) CUG CCG CGG Arg (R) G U A C A C Leu AUU ACU AAU Asn AGU Ser AGC (L) Ser (S) C AUC Ile ACC AAC Thr Lys (K) UG A AUA Pro AGA Arg AGG ACA AAA Lys AAG Asn (N) (P) AUG Met or start ACG His Thr (H) (T) Gln GUU GCU GAU Asp GAÇ GGU (Q) lle Arg (R) (1) GUC Val GUA GCC Ala GCA GGC Gly GGA GAA Glu OGAG GUG GCG GGG O 1 3 4 First mRNA base (5' end of codon) - U A GUca Gbc AG Third mRNA base (3' end of codon)What is the one-letter amino acid sequence formed from the following mRNA that codes for a pentapeptide that is an endorphin called Leu-enkephalin? 5' AUG - UAC - GGU - GGA - UUU - CUA - UAA 3'
- The following is a section of a messenger RNA: 5' GACUACAUA 3' Look at the sequence carefully and using the following genetic code, translate the MRNA into an amino acid sequence. Second Letter U A G Phe uCu UC | Tyr UGU Cys u UUU U UUC UUA UUG UAU UAC UAA UAG UGC Stop UGA Stop A Stop UGG Trp G Ser UCA UCG Leu CAU CAC САА CAG CU CU His CGU U c Cuc CUA CUG Leu cc CCA CG CGC Arg CGA CG Pro Gin A 3rd G 1st letter AUU Ser u letter ACU lle ACC ACA AAU Asn AGU Thr AAC AAA A AUC AGC AUA AGA | Lys A Arg G AUG Met ACG AAG AGG Asp GUU G GUC GUA GCU GAU GAC GAA GGU GGC Gly Val |GCC GCA GCG Ala GGA GGG A Glu GUG GAG G O Tyr-Val-Val O Asp-Tyr-lle O Leu-Met-Tyr O lle-His-Gln O Asp-Thr-Leu-Tyr-Thr-His-lle 星w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdfWhich of the following polypeptides (written from their N terminal ends) is encoded by the following mRNA? (hint: there is no left or write in a cell!) 3' GG AUG AGU AUA CUU ACG GGU GAA GUA CAU UAA CCC C5' O O O Met Lys Trp Ala Phe lle Met Ser lle Leu Thr Gly Glu Val His Tyr Lys Arg Thr Phe Tyr Met none of the above His Val Glu Gly Thr Leu lle Ser Met
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3 NH3+- Met-Leu-Phe-Val- COO- NH3+- Met-Thr-Val-Ser- COO- NH3+- Met-Glu-Gln-Ser- COO- NH3+- Met-Asp-Ser-Pro- COO- NH3+- Met-Lys-Phe-Leu- COO-
- Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?UCUGAUGGGCUUU... Beginning with the Start codon (for Met), which amino acids, in order, are coded for by this section of mRNA? Second letter threonine, methionine, glycine methionine, glycine, phenylalanine methionine, valine, glycine, phenylalanine serine, aspartic acid, glycine, leucine First letter G U UUU phe UUC. UUA UUG CUU CUC CUA CUG Leu Leu GUU GUC GUA GUG AUU AUC lle ACU ACC AUA ACA AUG Met ACG UCU UCC UCA UCG Val CCU CCC CCA CCG GCU GCC GCA GCG Ser Pro Thr Ala CAU CACJ CAA CAG UAU UGU UGC Tyr Cys UAC UAA Stop UGA Stop A UAG Stop UGG Trp G His Gln AAU Asn AAC AAA AAG Lys GAUT GAC GAAT GAG G CGU CGC CGA CGG AGU 1 Ser AGC AGA AGG GGU Asp GGC GGA Glu GGG Arg Arg DUAG DUAU DUAG ULAG Third letter Gly