3. What is something noteworthy about the following sugar modifications in terms of their structure/function relationship? (a) Sugar alcohols. Draw an example and name it. (b) Deoxy sugars. Draw the most important one! (c) Glycosides. Draw an example.
Q: Free energy diagrams are super fun to draw! Draw a set of free energy diagrams that show the…
A: Free energy diagrams have free energy (G) in Y-axis and reaction coordinate in X-axis. These can…
Q: What is the IUPAC name of the following compound? (No need to provide E/Z designation.) CO₂H
A: IUPAC name is 3,3,6-Trimethylhept-6-enoic acidExplanation:Step 1:Rules for IUPAC Naming Find the…
Q: 2) You are studying the tripeptide Lys-Val-Thr. a) Draw the full structure of the tripeptide…
A: Pepetides are composed of amino acids. Amino acids are biomolecules where a carbon atom (called…
Q: Ringlemann scale is used to analyze O a. Carbon monoxide Ob. Nitrogen dioxide O c. hydrocarbons O d.…
A: The objective of the question is to identify the substance that the Ringlemann scale is used to…
Q: BME (high concentration) disrupts O Disulfide linkages Accelerating disulfide cross-linking. Olonic…
A: BME stands for beta-mercaptoethanol. It is a chemical compound. It can act as a biological…
Q: 2. Compare and contrast the biological roles of the following amino acids the following pairs of…
A: The objective of this question is to compare and contrast the biological roles of three pairs of…
Q: If the Gibbs free energy change for the reaction; Succinate + FAD Fumarate + FADH2 is -40KJ/mol at…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Draw and label a diagram showing four DNA nucleotides, linked together in two strands. PLEASE DRAW…
A: Nucleic acids are biomolecules responsible for the storage and transmission of genetic information…
Q: Propose structures for intermediates A and B in the scheme below. This three-step conversion is…
A: Citrate is isomerized to isocitrate in the citric acid cycle via dehydration and rehydration. These…
Q: The table shows standard reduction potentials, E., for reactions with n transferred electrons.…
A: The objective of this question is to calculate the free energy change, ΔG°, for the reduction of O2…
Q: A partial diploid in E. coli is created so that LacI is no longer expressed from the genome and is…
A: Partial diploid E.coli has both chromosomal DNA (i.e. genome) and plasmid DNA, but all the genes are…
Q: Genetics Q3
A: The objective of this question is to identify the recombinant offspring and calculate the…
Q: A useful method for studying membrane proteins in place in the membrane is a. nuclear magnetic…
A: Membrane proteins are common proteins that are the part of biological membranes.
Q: bond (s) with the.. 7th and 9th amino acids in the sequence. 12th amino acid in the sequence only.…
A: In an alpha helix, each amino acid residue is hydrogen bonded to the amino acid residue four…
Q: -22 2. (10 pts) Overlapping part of wave function of C-O bond (from to + in x-axis) is expressed by:…
A: The detailed ans has been attached. Explanation:
Q: The following table provides data on three popular protein supplements. (Figures shown correspond to…
A: Let the number of servings of designer whey be 'x' and the number of servings of muscle milk be…
Q: 5. Trehalose, a disaccharide produced in fungi, has the following structure: CH₂OH H OH H H H H OH H…
A: a. α-D-glucopyranosyl-(1→1)-α-D-glucopyranoside b. Trehalose is not a reducing sugar.Explanation:…
Q: Question 31 of 35 What is K for a reaction if AG° =-51.2 kJ/mol at 25.00 °C? (R = 8.314 J/mol · K) +…
A: The objective of the question is to calculate the equilibrium constant (K) for a reaction given the…
Q: The molecule shown below is a monomer of ________. We know this because of the structure of the…
A: The correct answer is: b) DNA; B Explanation: Explanation:The molecule shown in the structure…
Q: H НО С CH₂OH I 5C 0-I H ОН | H -0, Н I-о- 2С ОН a-glucose 1C H ОН
A: If the OH group is placed below the ring on the anomeric carbon or first carbon of the cyclic ring…
Q: 12. Consider a protein that can exist in two forms: folded (F) and unfolded (UF). Calculate the free…
A: (i.) ΔGunfolding = 2100.30 J/mol or approximately 2.10 kJ/mol (ii.) ΔGunfolding = -5446.52 J/mol…
Q: Question 6
A: The question is asking whether a mouse would die if it was injected with heat-treated S strains.…
Q: 11. List 2 polysaccharides that provide structure and strength. What is interesting about the…
A: The objective of the question is to identify two polysaccharides that contribute to structure and…
Q: 4. Gentiobiose (D-Glc(ẞ1-6)D-glc) is a disaccharide found in some plant glycosides. Draw Haworth…
A: Gentiobiose has a beta-glycoside link, originating at C-1 in ring A and terminating at C-6 in ring…
Q: List 4 major types of inhibition modes and clearly indicate the effect on Vmax and KM for each mode?
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Hyperacetylation of histone tails is often associated with: Question 22 options:…
A: Loose conformation of Chromatin Explanation:Histone connections with DNA become weaker by…
Q: Genetics Question 24
A: The question is asking for the number of sister chromatids in a unicorn cell at metaphase of…
Q: Genetics 8 Q7
A: The objective of the question is to understand the possible outcomes of non-disjunction in a female…
Q: Choose the correct structure for thiamine hydrochloride at pH 3. H3C H3C NH₂ NH₂ CI- A CI- с CH3 CH3…
A: The relationship between pH and pKa is described by the Henderson-Hasselbalch equation:pH = pKa +…
Q: Extension Questions Which of the following sequences correctly represents the flow of electrons…
A: Extension questions •The correct sequence representing the flow of electrons during photosynthesis…
Q: Provide a stepwise, arrow-pushing mechanism for the following transformation. You may use general…
A: The reaction in question involves a lysis reaction catalyzed by a lyase enzyme using the coenzyme…
Q: Derive an Equation that explains the realtionship between kE and kN with respect to the equilibrium…
A: Equation: This reaction is governed by the equilibrium constant , where: - (1)Assuming that…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: You have isolated a new trisaccharide from a new species of insect shown below that you are calling…
A: Since you have posted multiple questions, we will provide the solution only to the specified sub…
Q: Assuming I got 1, 2, and 3 right can you please help with 4?
A: The objective of this question is to determine which generation the phenotype of the F2…
Q: Which of the following statements is most accurate ? All statements are accurate All prescribed…
A: The objective of the question is to identify the most accurate statement among the given options…
Q: The following phenylboronate is a competitive inhibitor of a chymotrypsin-like enzyme. Unlike…
A: The competitive inhibitor is the compound that binds to the active site of the enzyme where the…
Q: You have a protein with MW 48kDa. How many grams of protein are in a 200 mL sample at 50 μM?
A: To calculate the amount of protein in grams in a 200 mL sample with a concentration of 50 μM, follow…
Q: ANSWER A AND B PLS
A: To determine the Vmax and Km in the absence ofinhibitors, we can use the Michaelis-Menten equation,…
Q: What percentage of max is obtained when the substrate is present at 80% of the Km? Use two digits in…
A: is the maximum velocity attained by an enzyme during a reaction. is the substrate concentration at…
Q: 8. Draw the product(s) for the following biosynthetic reactions catalyzed by enzyme listed below the…
A: 1.2.3.4.5.
Q: he monosaccharides shown below are: a Diastereomers b Enantiomers c Epimers d…
A: Configurational isomers are those that do not inter convert rapidly under normal conditions and are…
Q: D. Explain why a protein (polypeptide chain) will assume a different 3-dimensional structure in: (1)…
A: The three-dimensional structure of a protein, also known as its native conformation, is critical for…
Q: Imagine the main chain of a protein bends back on itself, so that two amino acid residues R, and R,…
A: Salt bridge is a bond between amino acids which carry opposite charges. The opposite charges exert…
Q: STEM Workplace Practices Q3
A: The objective of the question is to understand the purpose of release-testing in the context of…
Q: List three important characteristics of plasmids and their function
A: Here is the Three important characteristics of plasmid and their functions.Autonomous…
Q: Alternative splicing: Question 15 options: results from non-spliceosome mediated splicing. is…
A: One notable difference between prokaryotic genes and eukaryotic genes is that prokaryotic genes do…
Q: [AktivGrid] Draw the product of the reaction of isocitrate catalyzed by isocitrate dehydrogenase in…
A: Kreb cycleKreb cycle or citric acid cycle or tricarboxylic acid cycle (TCA) is a sequence of…
Q: QUESTION 5 Carbohydrates supply which element for the construction of other biomolecules? carbon…
A: Carbohydrates supply the element carbon for the construction of other biomolecules. Carbon is a…
Q: If non-disjunction occurs at meiosis 2 in a male, 2 of the 4 sperm formed in that meiosis will have…
A: Non-disjunction can happen in meiosis 1 or meiosis 2.Non-disjunction is said to have taken place in…
Step by step
Solved in 5 steps with 3 images
- 1. By drawing, construct a model of glycerol and three short fatty acids: a four-carbon saturated fatty acid, a four-carbon unsaturated fatty acid, and a five-carbon saturated fatty acid. Perform three dehydration synthesis reactions to produce triglyceride. Research the structure of one steroid of your choosing, and build the steroid. Which functional groups are involved in the dehydration synthesis reactions in Step 2? What are the waste products in this reaction? What are the subunits of a triglyceride? What is the C:H:O ratio for fatty acid chains disregarding the carboxyl?1. Examine the synthetic glycoprotein, Molecule A, shown below: Protein- OH OH OH OH OH ÓH OH Molecule A OH Draw the structures of the products obtained when Molecule A reacts under the following conditions. Justify your answer. If no reaction occurs, explain why. The monosaccharide rings that have not reacted may be represented by an “R" group. Mechanisms are not required. (а) Ammonium Carbonate, 5 days. (b) Excess Sodium Periodate. (c) 2,3-dinitrophenyl hydrazine under reductive amination conditions. NO2 O2N. „NHNH2 2,3-dinitrophenyl hydrazine13. One or more of the compounds shown below will satisfy each of the following statements. Not all compounds may be used; some may be used twice. Put the letter(s) in the blank. (a) Found in chitin. (b) An L-saccharide. (c) The first residue attached to asparagine in N-linked glycans. (d) A uronic acid. (e) A ketose. CH,OH COO CO- H OH H OH ОН Н но OH OH H H но OH Но - CH3 óso, NHC- OH (a) (b) (c) CH,OH CH,OH CH,OH c=0 CHOH C=0 H-C-OH CH,OH но-с—н ČH,OH CH,OH (d) (e) (f) 우
- 2. Draw the ringed form of D-glucose with the following modifications: (a) Convert to sugar acid at C-6. Name this one! (b) What if that molecule is modified to ALSO have a -COOH at carbon 1? Draw its Fisher projection and what it is named? (c) How might the COOH group(s) lead to new chemical functionality?1. Make a series (at least 3) of drawings to show the three dehydration synthesis reactions that take place between the two Fatty Acids, the Phosphate Head and the Glycerol. Show the water molecules made. a) Label the following on the completed phospholipid: hydrophilic and hydrophobic parts of the molecule, fatty acids, phosphate group, and glycerol. b) Compare the structure of the phospholipid to that of a triglyceride. How are the two molecules Similar? How are they different? 2. Use the following vocabulary to label and draw a cell membrane: cytoplasm (cell lumen) extra-cellular fluid hydrophobic hydrophilic polar head non-polar tails a) How many O-H groups are there? And are the O-H areas of sucrose polar or non-polar? b) What is the term that is used to discuss how tightly or loosely an atom's nucleus has a hold of its valence electrons?4. Amphiphilic Lipids. Detergents are small amphiphilic molecules that tend to form micelles in water. (a) Draw the structures of sodium dodecyl sulfate (SDS) and Triton X-100 (b) For each drawn detergent, indicate which portions (ends) of the molecules are hydrophilic and hydrophobic. Justify your answer (explain why hydrophilic vs hydrophobic). (c) Draw the micelle structure for one of the detergents. (d) Why does the detergent form a micelle and not a bilayer? Why do detergents denature proteins and remove grease from your clothing?
- 22. Describe the beta position of the hydroxyl group on the anomeric carbon in a cyclic sugar. (219. Which statement is TRUE of sphingolipid synthesis? 1.All of the carbon atoms of palmitate and serine are incorporated into sphingosine. 2CDP-sphingosine is the activated intermediate. 3CO2 is produced during the synthesis of ceramide from palmitate and serine. 4Glucose 6-phosphate is the direct precursor of the glucose in cerebrosides. 5Phosphatidic acid is a key intermediate in the pathway.2) A. What is meant by energetic coupling? What is meant by the term phosphorylation and what role does phosphorylation play in energetic coupling? B. Describe at least one actual example of energetic coupling.
- 1. Calculate the pH of a 0.05 M solution of HCl. 2. Calculate the pH of a 0.1 M solution of NaOH. 3. Calculate the pH of an acetic acid solution in which [CH3COO - ] = 0.037 M and [CH3COOH] = 0.044 M. (pKa = 4.76) 4. You are conducting a biochemical experiment with an enzyme that has optimal activity at pH = 10.00. You decide to use carbonate (pKa1 = 6.38, pKa2 = 10.30) as the buffer to keep the pH stable throughout the enzymatic reaction. (Recall that the formula for carbonic acid is H2CO3.) You prepare a 0.5 M solution of carbonate buffer at pH = 10.00. Calculate the concentrations of the major carbonate species in your solution. 5. Calculate the pH of the buffer solution in which [H3PO4] = 0.038 M and [H2PO4 - ] = 0.046 M (pKa1 = 2.12, pKa2 = 7.21, pKa3 = 12.32). 6. Add 5.0 mL of 0.1 M NaOH to 80 mL of buffer from question 5 and calculate the pH.3. Below is an image of sucrose. HO OH OH HO- HO OH OH НО (a) Using sucrose as a substrate, draw a schematic reaction for a general glycosidase. Explain whether your mechanism corresponds to an inverting or a retaining type enzyme. C :) (b) The two products can occur in a range of forms in solution. How many forms might you expect in this case, and explain how these interconvert. C 21. Consider the three-dimensional model of the tertiary structure of an enzyme below. Amino acids involved in binding are shaded blue, and amino acids involved in catalysis are shaded red. A. Suppose research has shown that amino acid 82 in the red shaded region is lysine, an amino acid with a positively-charged side chain. This lysine is critical for catalysis. Other studies have found that amino acids 12 and 62 in the blue region are both phenylalanine, an amino acid with a nonpolar side chain, and are critical for substrate binding. These amino acids are relatively close in the active site but are separated by 20-70 amino acids in the primary structure. Using what you know about protein structure, explain how amino acids separated in the primary structure can come close together in the active site. B. Use this information and figure 4.2 in your book to answer the following questions: Do you think changing amino acid 82, lysine, an amino acid with a positively-charged side…