Calculate the CFU/mL of the original culture for the countable plate as shown in the diagram. b) How many colonies would you expect if you plated out 0.1 mL from Tube C. c) How many colonies would you expect if you plated out 1.0 mL from Tube C.
Q: Which of the following outcomes is most likely to occur if pure phospholipids are added to water?…
A: A phospholipid molecule has two hydrophobic fatty acid tails and one hydrophilic phosphate moiety,…
Q: What is RNA sequencing ?
A: Most living organisms that are well-staed to define as they have DNA as their genetic material. It…
Q: number 32
A: Introduction:- A basic unit of heredity and a sequence of nucleotides in DNA that encodes the…
Q: When SARS-CoV-2 replicates in cells, mutations can occur in the virus’s genome. When mutations have…
A: Mutation The replacement of one nucleotide base with other nucleotide base is known as mutation.
Q: Make a simplified schematic representation of the connective tissue cell lineage derived from…
A: The connective tissue cell lineage derived from hematopoietic stem cells and their functions.
Q: alanine that would exist at the pH indicated below.
A:
Q: Lola Fe is 80 years old. She claims that she’s been getting shorter every year, and that soon she’ll…
A: Different bodily changes occurs due to the increase in age. The height is a factor which is…
Q: Can you please make a conclusion for this? Thank you so much! Suppose you counted 79 R_ and 33…
A: Mendel's monohybrid cross involves the mating between individuals with different traits for a single…
Q: viral and human transcription is different. What molecule is used as a template strand for the viral…
A: Transcription is the process of making RNA copy of a gene sequence. It takes place in nucleus.
Q: When KO techniques was developed ?
A: The full form of KO is knock out and refers to gene knock out which means the gene that is knocked…
Q: If a population is experiencing directional selection with respect to wing color, what type of…
A: Natural selection drives the process of evolution.
Q: 14 15 16 8 10 12 6. 13 17 10 11 Male Female
A: Male : * 1 is kidney * 2 is renal vein * 3 is ureter * 4 is renal artery * 5 is testis * 6 is…
Q: The species of the Galápagos Islands (a) are similar to those on other islands at the same latitude…
A: Scientists believe that all continents existed as a single landmass millions of years ago. Later, as…
Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…
A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…
Q: Discuss the role of par genes in generating anterior/posterior polarity in the C. elegans embryo.
A: C. elegant is a nematode that is used as a model organism in developmental research. Six proteins…
Q: Decide whether the statement is TRUE OR FALSE. Justify your answer. 1. Introns are coding regions of…
A: 1. Introns are coding regions of the DNA that becomes part of the mature mRNA after splicing.…
Q: Discuss the eukaryotic transcription process and mention the enzymes and components needed in the…
A: Cell is the basic structural and functional unit of life. All cells contains nucleus within which…
Q: TRUE OR FALSE? The interdependent evolution of similar organisms whose members freely interbreed in…
A: INTRODUCTION When two or more species evolve together within a time period due to their close…
Q: Define microevolution.
A: Introduction:- Evolution is the process of a species' features changing over numerous generations…
Q: RNA molecules differ from DNA molecules in that they * a. are single stranded rather double…
A: Codon is a sequence of three DNA or RNA nucleotides. Codons encode the amino acids which eventually…
Q: - research and explain about the genetic drift -differentiate founder effect from bottleneck…
A: Introduction Evolution:- Evolution is a process of gradual change in the characteristics of a…
Q: meiosis
A:
Q: Test Metabolic process indicated by a positive test. Citrate Indole Catalase Urease Methyl Red/…
A: Citrate test- are used to detect the use of citrate by an organism. Indole- it differentiates the…
Q: Combining your knowledge of rates of diffusion with yourknowledge of muscle physiology, explain why…
A: Slow-twitch (Type I) fibres, which are characterised by muscles with lengthy contraction duration…
Q: Explain how and why the queen honey bee abort the sexual maturation of the worker bees?
A: Honey bees are eusocial insects.These insects have permanent division of labour.
Q: describe the events that occur over the 6 day period following fertilization of an ovum
A: An ovum or egg is the female gamete of an individual. It can fertilize with the male gamete to form…
Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…
A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…
Q: 1. What are the target cells of SARS-CoV-2? What do these cells have in common?
A: Many scietific studies have confirmed that SARS-CoV-2's spike protein attaches to…
Q: 17a. Assuming that both types of pom-poms are present in the population, what do you think would…
A: *Natural selection is due to when individuals of genotypes are more likely than individuals with…
Q: Meiotic double strand breaks are repaired by SPO11. * True false
A: Meiotic recombination is the process of reciprocal exchange of genetic material (DNA) between the…
Q: Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to…
A: Here I will provide you first 10 nucleotides long mRNA sequences according to question.
Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…
A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…
Q: Splicing regulatory (SR) proteins bind at exon to recruit U1snRNP and U2 snRNP during RNA splicing.…
A: There are few important points about splicing apparatus are as follows: The central component of…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: Compare the overall body structure of the cave fish and the minnow below. cave fish minrow 1. What…
A: Cave fishes These fishes are called so because they have adapted themselves to live in caves and…
Q: Which anatomical skull structure articulates with the vertebral column O mandibular condyle O…
A: The skull is the bony, hello, round shaped structure of axial skeleton system, that protects our…
Q: 28. According to the central dogma of genetic information transfer (proposed by James Watson and…
A: Central dogma proposed by James Watson and Francis crick states the genetic information transfer in…
Q: What seems to be the function of the spindle fibers ?
A: Spindle fibers are a network of threads like filaments that are forms during the cell division…
Q: Is GG a genotype or phenotype? __________ What gamete(s) are possible from a plant that is GG?…
A: * phenotypes means observable physical properties of individual like organism appearance and…
Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…
A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…
Q: Are gender traits completely a result of societal expectations?
A: The answer is NO. It's not true always.
Q: What is body mechanics? Discuss at least 3 principles of body mechnics
A: DEFINITION:- Body mechanics is defined as a way to hold the body for peak efficiency during a…
Q: What is the significance of the fact that couples who cannot taste PTC never have children who can?…
A: 1. couples who cannot taste PTC never have children who can taste PTC because when we cross between…
Q: DNA gyrase manages DNA tangles and supercoils by breaking DNA strands to allowing DNA to rotate into…
A: Introduction:- During cell division, DNA replication is the process by which DNA duplicates itself.…
Q: A two-month-old baby is found to lack class I MHC molecules. How would this defect impact his…
A: A large locus present on vertebrate DNA known as the Major Histocompatibility Complex (MHC), has a…
Q: HAZARD AND VULNERABILITY IDENTIFICATION AND ASSESSMENT OF MINING AFFECTING RIVER
A: Water pollution is the polluting of streams, rivers, lakes, seas, or groundwater by pollutants…
Q: we read that in tumor cells Rb protein is hyperphosphorylated. In response to that, will p53 level…
A: Phosphorylation leads to interdomain locking, which alters the structure of pRb and inhibits it from…
Q: Intermembrane space II IV 20000 00000 II NADH 1/2 02 Mitrochondrial inner membrane Matrix Figure 1.…
A: Cellular respiration is a metabolic phenomenon takes place inside the cell in which glucose is…
Q: Why do signals indicating damage to cells result in increase in the expression of p21Cip1?
A: Cell cycle progression is tightly controlled by cyclins and cyclin-dependent kinases (CDKs), the…
1. Calculate the CFU/mL of the original culture for the countable plate as shown in the diagram. b) How many colonies would you expect if you plated out 0.1 mL from Tube C. c) How many colonies would you expect if you plated out 1.0 mL from Tube C.
Step by step
Solved in 2 steps
- EcoRI 4359 Aatll - Zral 4284 Bei 4209 BsrBl 4205 Clal - BspDI 23 Hindill 29 EcoRV 185 Bmtl - Nhel 229 Sspl 4168 Earl 4155 Acul 4048 Xmnl 3961 Hincll 3905 Scal 3844 BamH 375 Sgrl 409 Banll 471 Banll 485 Вы 3787 Bsl 3759 Bgl 528 Sphl 562 EcoNI 622 Sal - Acct - Hincll 651 Pvul 3733 Pstl 3607 Bartl 3602 Pshl 712 Asel 3537 Eagl 909 Bell 949 Bsal 3433 BarDI 3420 Nrul 972 PBR322 4,361 bp BstAPI 1045 Ahdi 3361 BspMI - Bfual 1063 PAMI 1315 Bsml 1353 PAMI 1364 Acul 3000 Ori Styl 1369 Aval - BsoBl 1425 PpuMI 1438 Msel 1444 Bigl 1447 Ppu 1480 AlwNI 2884 Bell 2777 kI 2682 rop Drdi 2575 Bsgl 1650 BspEI 1664 Pcil - Afl 2473 rBl 2404 Earl 2351 Bspol - Sapl 2350 Ndel 2295 BstAPI 2291 Bsaß 1668 Xmat 2029 Pvull 2064 BsmBI 2122 Dndl 2162 BstZ171 - Acct 2244 Bsal 2225 TthI- PI 2217 Figure 1 If your gene of interest was inserted at the Sphl restriction site of the plasmid illustrated in Figure 1, describe the screening process to select the positive recombinants.Based on the image below, select the correct statement. Complex II QH₂ Q- 10 2 HO 2 HO Fe-S (2.8 FADH₂ FAD- Succinate Fumarate https://canvas.uts.edu.au/assessment questions/356986/files/1562694/download? 2e verifier-eUTT3hYal2YYTWlywV8TIFA3USmzCsM52jECmvTo O Succinate is reduced to fumarate O Succinate is oxidised to FAD O The Fe-S center shuffles electrons from FAD to ubiquinone (Q) O The Fe-S center shuffles electrons from FADH2 to ubiquinone (Q) The Fe-S center shuffles electrons from FADH2 to ubiquinonol (QH2) W 88 16°Co 9:.9 * Asiacell Iı. إجابتك Q9/what is the name of theses ? structures from 1 to 6 61 3 إجابتك Q10/This is ..formed by and
- A physician order s Sentamycin 40mg lvqah fur a'child who The recommended do3age fur childrenis 3 - bmgl ) weighs 24 1bs. Kgl day In three divided doses . a what recummended minimum E maseimum daily dosages are the for this child ? b) what are the cmmended minimum single recor dosages fur this child? c) Is the ordered dosage safe ?SHowe WORKINTS have be en asise d to decrease the num ber The nur ses of gauze pads used when Completing dresses changes by 15*%0. Currently, the unit Orders b,500 Small pads 9) How many gauze pads of each size usill now need to be ordered every month. gauze and 6,250 large gauze pads euery monthKCI for injection contains 40 mEq in 20 mL. An order requires 15 mEq, how many mL are needed?
- The order is for Streptomycin 1gm IM. You have a 5gm vial of Streptomycin . The label states to add 9ml of sterile water to yield 400mq / m * l How many ml will you give?22:23 1O 000 · 11:24 A9 OB1 r ll l 52% . +964 782 734 3923 2m541139927815107... Patient Encounter Part 3 The pretreatment workup is summarized below. Pathology: 47-year-old female with new diagnosis of infiltrating intraductal adenocarcinoma involving the left breast and regional node. Further tests on tumor samples indicated ER (8%), PR (negative), HER2 (negative), Ki-67 (72%), and grade (poorly differentiated). Intrinsic subtype (luminal B, HER2-negative). Radiology: FDG-PET/CT indicated a 5.3 x 2.5 cm mass in the left breast which appeared to extend to the epidermis of the skin; one node in the left axilla was also involved with tumor. No other evidence of distant disease was visualized. Laboratory: CBC, liver, and kidney function tests WNL, alkaline phosphatase and calcium are normal also. Stage: IB (T, N, M,) List the most important prognostic factors in this patient with newly diagnosed breast cancer. Assess the patient's level of risk for relapse. 50 SECTION 16 | ONCOLOGIC…The Order is for o)alacin C 30omg 9sh lv. The drug is available in a vial containing aml Ê labeled 900mg doses of o)alacin will youget frum this vial ? How many
- Z40 7 @ ۱۲:۶۲ لا يوجد SIM و السؤال Roller compactor and chilsonators are used in preparation of granules of aspirin. false true حفظ الإجابة1&3/4 tbs po BID x 7 days #QS How many milliliters should the pharmacy dispense? this isnt 364 mLPO Aav DAV == AaBbCcDdEe AaBbCcDdEe AaBb CcD AaBbCcDdE Normal M H No Spacing Heading 1 Heading 2 Question 5 a) Explain the general principles by which medical images may be obtained through the use of radiopharmaceuticals and a gamma camera. b) Explain the use of radiopharmaceuticals in i) Myocardial perfusion scans ii) Skeletal scintigraphy 20 ¶