CHLORINATION IS 1. by means of special water treatment 2. the physical method of water purification 3. chemical method of water treatment 4. chemical method of water disinfection 5. physical method of disinfection
Q: Some of the biochemical reactions of GLYCOLYSIS are known to have a positive deltaG0, e.g. the…
A: The ΔG° of the reaction in the direction of glyceraldehyde 3-phosphate and dihydroxyacetone…
Q: Label the different parts of stems in the images below: Primary phloem Secondary phloem Vascular…
A: Vascular bundles are organised in a circle all around the pith inside the Dicot Stem. There are four…
Q: Lab 10- PCR For the following equipment, know what it looks like, its name, and its function:…
A: 1) A micropipette is a laboratory instrument used to accurately and precisely transfer volumes…
Q: How this Bacillus cereus can be find? what kind of testing require ? Is it through plate or brooth…
A: Bacillus cereus is a Gram-positive, rod-shaped, facultatively anaerobic, flagellated,…
Q: In Drosophila, the following genes and mutations are known: Wingsize – recessive allele for tiny…
A: Alleles are the alternative form of gene that are located on the same locus of homologous chromosome…
Q: Which of the following are accurate related to the ethical considerations with the Tuskegee Syphilis…
A: The Tuskegee Syphilis study or the Tuskegee study of untreated Syphilis in the negro male was a…
Q: how the body can stimulate the tissue metabolism
A: Metabolism which is basically an act of balancing the bodily functions includes two processes and…
Q: There are tiHee SUUIcesUII down five (5) examples for each hazard. Human Factor Hazards Equipment…
A: A hazard is a source of potential damage, harm or adverse health effect on something or someone.…
Q: B.cereus
A: Bacillus is a genus of rod shaped, gram positive aerobic or facultatively anaerobic bacteria found…
Q: Which protein is NOT necessary to initiate DNA replication in E. coli? A. helicases
A: The biological process of making two identical DNA replicas from a single original DNA molecule is…
Q: Cystic Fibrosis is caused by a mutation in the CFTR gene, and an ideal form of treatment would be to…
A: Cystic fibrosis is an inherited life threatening disorder that causes severe damages to lungs,…
Q: 11. An eosinophil is classified as a A. Red blood cell B White blood cell C. Platelet D. Hemoglobin…
A: Blood is a kind of connective tissue. It connects different body parts. The blood transports gases…
Q: The pigments, energy reserve products, and cell walls found in land plants are also characteristic…
A: Introduction A cell wall is a structural layer found just outside the cell membrane that surrounds…
Q: The following strand is a template strand: 3-АТСТАСССТТCGACTAGAАСААСТ-5' The non-template strand is…
A: Given, Template strand : 3'-ATCTACCCTTCGACTAGAACAACT-5'
Q: Why are the protists considered paraphyletic?
A: A group is paraphyletic in taxonomy if it contains the group's latest common ancestor and the…
Q: Which of the following is NOT true of Aspergillosis?
A: Aspergillosis is an infectious disease caused by Aspergillus fumigatus, saprophytic fungi. It can…
Q: A good number of snail population in the stagnant waters between rice paddies is growing under…
A: Population Density: The total concentration of individuals of a species within the same geographic…
Q: To determine: Whether the heat-detecting ability of vampire bats and snakes is a homologous trait or…
A: The basis of evolution is that all living things share a common ancestor, and some similar traits…
Q: Why do eudicot trees tend to be wider at the base than atthe top?
A: A eudicot is a flowering plant that has two seed leaves, or cotyledons, in its embryo. These plants…
Q: what is radiation in Thermoregulation??
A:
Q: What management implications arose from Clements’ theory of succession? How hascontemporary…
A: 'A developmental process through which the community underwent a well-defined series of stages that…
Q: Secretors (genotypes SS and Ss) secrete their A and B blood group antigens into their saliva and…
A: Given: Secretors (genotypes SS and Ss) secrete their A and B blood group antigens into their saliva…
Q: Column 1 will list ALL characteristics you have identified or tested (include a Gram reaction, shape…
A: There are few important points that should kept in mind : As we know that bacteria are microscopic…
Q: What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5'…
A: In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by reverse…
Q: If a plant that is heterozygous for seed color is crossed with a plant that is homozygous recessive…
A: A trait is characteristic feature that is unique to particular individual. According to question ,…
Q: 3. Please select all true answers. Myosin I is simple and often associated with the plasma membrane,…
A: Myosins are the motor proteins based on actin filament.
Q: Tectorial membrane Stereocilia Inner hair cell Outer hair cell Supporting cells Sensory and motor…
A: Ear is the hearing organ. It collects the sound and send the message to the auditory vesicle in the…
Q: What are the assumptions of the Hill equation? A. The total number of binding sites will be filled.…
A: The answer is (e) none of the above .
Q: Suppose you are researching a new protein and find that the shape of the protein yields little…
A: Suppose you are researching a new protein and find that the shape of protein yields little…
Q: س 1/ 1 درجة the percentage of lymphocyte is-4 .A 20% .B 30% .c 10% .D 50% بأختيار الاجابة الصحيحة س…
A: Lymphocyte- it is a type of white blood cell in the immune system of most vertebrates is known as…
Q: Match the molecules (List 2) with the cell structures in which they are involved (List 1). A cell…
A: A Cell is made up different molecules that help it in maintaining its structure and function.…
Q: (A) G= N K – N) K (C) (B) (х-аxis) Question: What does the dotted line represent? O a. carrying…
A: The nature of increasement of individuals in a population is known as growth form. Characteristic…
Q: Typically, vascular tissue is organized as____ in stems and as____ in roots. a. multiple vascular…
A: Introduction :- The xylem and phloem, which are plants' major transport systems, make up vascular…
Q: During which process of photosynthesis is water split and oxygen released? Calvin Cycle photosystem…
A: Photosynthesis is the process of conversion of CO2 and water molecule in sugars and oxygen.
Q: germinate
A: The germination of the seeds should be done in following steps :- 1) use of fresh and soaked…
Q: Prove if the statement is TRUE or False with complete solution. At a dilution factor of,…
A: Data on colonies grown after plating pasteurised milk samples is provided. Because each cell…
Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…
A: The process of converting DNA instructions into proteins is known as the central Dogma.
Q: Decomposing organic matter in soil is called______ . a. clay d. silt b. humus e. sand c. topsoil f.…
A: Introduction In the soil, there are numerous bacteria and other microbes that can breakdown organic…
Q: Which of the following is an explanation for independent assortment of alleles on different…
A: ANSWER;- B) In metaphase I, the alignment of 1 pair of replicated chromosomes does not affect the…
Q: Strain X. spp. is a rod-shaped, anaerobic, Gram-positive bacterium with peritrichous flagella and…
A: Doubling time is the time required by a cell, in this case the bacterial cell, to divide and produce…
Q: True or False. If drug A produces a larger zone of inhibition than drug B on the Kirby-Bauer disk…
A: Introduction If drug A does produce a larger zone of inhibition, that is one positive attribute of…
Q: What physical activity that can change the body fluids and how to restore and maintain to normal
A: Liquid balance in body is a part of the homeostasis of organisms where how much water in the…
Q: Which statement about the three domains of life is TRUE? Archaea is most closely related to…
A: Although both bacteria and archaebacteria are single-celled prokaryotes, they differ in their…
Q: A black guinea pig is mated to a white guinea pig, and they produce 12 black offspring. Then, the…
A: A trait is a characteristic features that is unique to particular individual . As per the data :-…
Q: SCREENED BACTERICIDE LAMPS SHOULD BE INSTALLED IN 1. premises for pharmacy visitors 2.…
A: the answer is 4 Screened bactericidal lamps should be installed in distillation rooms and…
Q: Which of the following proteins is made by ribosomes that are free in the cytoplasm (NOT on bound…
A: Protein are synthesized by membrane free and membrane bound ribosomes.
Q: To determine: Whether the compounds produced b insects that are similar to natural painkillers are a…
A: Referred pain is the sensation and feeling of pain in the body as if it occurred or was generated in…
Q: We run the HinDIII-digest of lambda-DNA as the standard ladder on the gel. Number the largest…
A: Restriction enzyme or restriction endonucleases are the enzymes that cleaves DNA at specific sites…
Q: Baldness is a phenomenon where individuals lose hair as they grow older. As an X-linked recessive…
A: Baldness is always an sex influenced trait, i.e., an allele is dominant in one sex but recessive in…
Q: Interpret the data given in the table below. Explain your answer. (Flooding of transplanted wetland…
A: Weed management Weed management is an agricultural practice in which the effective measures to…
Step by step
Solved in 3 steps
- ILLUSTRATIONS: 1. Sterilizers seen in the laboratory and their parts.Which of the following terms is an absolute condition? Degermation Disinfection O Sanitization O SterilizationExamine the given sets of table below. Which disinfectant is the MOST recommended? Support and Justify your answer. Table 2. Phenol Coefficient of Test Disinfectant Name of disinfectant Growth after 5 minutes Dettol Phenol Name of disinfectant Z-germicSide Phenol Dilution 1:100 1:125 1:150 1:175 1:200 1:95 1:100 1:105 1:110 1:115 Dilution 1:100 1:125 1:150 1:175 1:200 1:95 1:100 1:105 1:110 1:115 - + + + + * + Growth after 5 mins + + + Growth after 10 minutes + + + + Growth after 10 minutes + + * Growth after 15 minutes + + + + + Growth after 15 mins + P .. + 9. + + +
- In sterilization, which among the supplies, instruments, glassware, etc. under the list of materials can be sterilized using either or both equipment below? List them down. For "autoclaving" For Dry heat oven Can be sterilized only sterilization with either Materials: 200-ml Erlenmeyer flask Stove 500-ml Erlenmeyer flask Autoclave 10-ml graduated cylinder Analytical balance 100-ml graduated cylinder pH meter Spatula Stirring rod 100-ml beaker Test tubes Distilled water Petri dish Stirring rod Alcohol lamp Glass dropperDisinfectants and Sterilization Procedures Complete the table by putting (+) for growth of microorganisms or (–) absence of growth of microorganisms. Disinfectant Concentration Growth after time of exposure (minutes) Control 5 minutes 10 minutes 15 minutes Sodium hypochlorite 5% Sodium hypochlorite 0.05% Alcohol 70% Alcohol 40% Iodophor (Betadine) 10% solution Mouthwash Cetylpyridinium Chloride - 0.075% Sodium Fluoride - 0.05%What is the minimal concentration (MIC) for disinfectant number 1? Just write the corresponding number including the decimal as written. ug/mL. Disinfectant 1 2 3 4 concentration 0.1 ug/mL +++ ++++ ++ +++ 0.2 ug/mL ++ ++ + ++ 0.5 ug/mL + + 1.0 ug/mL 5.0 ug/mL subculture 1 2 3 4 0.1 ug/mL ++++ ++++ ++++ ++++ 0.2 ug/mL ++++ ++++ ++++ ++++ 0.5 ug/mL ++++ ++++ ++++ 1.0 ug/mL ++++ 5.0 ug/mL Submit response
- Examine the given sets of table below. Which disinfectant is the MOST recommended? Support and Justify your answer. Table 2. Phenol Coefficient of Test Disinfectant Name of disinfectant Growth after 5 minutes Dettol Phenol Name of disinfectant Z-germicSide Phenol Name of disinfectant Jik Phenol KEY:- = No growth, + = Growth Dilution 1:100 1:125 1:150 1:175 1:200 1:95 1:100 1:105 1:110 1:115 Dilution 1:100 1:125 1:150 1:175 1:200 1:95 1:100 1:105 1:110 1:115 Dilution 1:100 1:125 1:150 1:175 1:200 1:95 1:100 1:105 1:110 1:115 + + + + + + + + Growth after 5 mins + + + + + + + Growth after 5 mins + + + + + + Growth after 10 minutes + + + + + Growth after 10 minutes + + + + + Growth after 10 mins + - + + + + + + Growth after 15 minutes + + + + + + Growth after 15 mins - + + + + + Growth after 15 mins + + + + - + + + +Tell me three things about how cultures are handled in a clinical laboratory.In pharmaceutical companies, Sterilization is an important step for quality assurance and approval of pharmaceutical products. Based on this concept, answer the following questions. Heat sensitive liquids need special methods for sterilization. Explain the methods applied in details.
- Evalutation of Antiseptics/Disinfectants - Filter Paper Disk Method3. For each category of microbial control, list examples. Sterilization Disinfection Sanitization/ Antisepsis/ Degermation Alcohol Decontamination AutoclaveWhich physical or chemical agent would be the best choice for sterilizing the following items: glass pipettes, tryptic soy broth tubes, nutrient agar, antibiotic solution, interior of a biological safety cabinet, wrapped package of plastic Petri plates? Explain your choices.