Mutation a change in the DNA Point mutations - when a single nitrogen base is deleted, inserted or substituted. Frameshift Mutation- when many amino acids coded for are different because of an insertion or deletion. The following example shows how these 3 kinds of mutations work. Fill out the RNA and protein for each and compare the mutations to the original. The mutation is in bold. Original DNA TAC GCG TGC ACG ATG CAG TAG TAC RNA Protein Mutation 1 DNA TAC GCG TGC ACG ATC CAG TAG TAC RNA Protein 20.10 Type of Mutation: Mutation 2 DNA TAC GCG TGC TCG ATG CAG TAG TAC RNA Protein Type of Mutation: Mutation 3 DNA TAC GCG CTG CAC GAT GCA GTA GTA C RNA Protein Type of Mutation:
Q: Urgently needed
A: To answer your questions, we first need to determine the Open Reading Frame (ORF) from the provided…
Q: Determine whether the reproductive behavior is evolutionary stable or unstable: Cowbirds are nest…
A: Here's why: Fitness Benefit for Cowbirds: Cowbirds benefit from this behavior by avoiding the costs…
Q: State the percentage range of the fresh weight of animals that is made up of water, and situate…
A: The objective of the question is to understand the percentage of water that makes up the fresh…
Q: make sure it’s correct i need asap
A: To graph the data and identify survivorship type, possible density-dependent factors, and…
Q: 5'......TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAAactgt... 3' a). (10 points). In the above sequences,…
A: The provided text appears to be a scientific question about mutations in a protein sequence. Here's…
Q: To the right is an image of a dilution that was performed. The volume above the top arrow indicates…
A: a. Volume of Stock Solution for Tube 1:To achieve a final concentration of 0.4 µg/ml in a total…
Q: Fraction of Age Individuals surviving RS of survivor RS of survivor carrying A, allele carrying A₂…
A: The question is asking for the interpretation of a table that represents the survival and…
Q: 5. The autoclave raises the atmospheric pressure to _____ : a) 10 psi b) 15 psi c) 20 k joules d) 25…
A: Approach to Solving the Questions:To answer the questions, it's essential to understand the concepts…
Q: In the initial encounter with the male intruder, resident male Cray fish showed extreme aggressive…
A: Based on what you know about serotonin an octopamine function, does the above situation of the…
Q: both please
A: Step 1: Question 1: False.Despite increased awareness and access to information about food…
Q: Marasmus is associated with ____. a. changes in skin and hair pigmentation b.…
A: The question is asking to identify the symptom that is associated with Marasmus, a severe form of…
Q: Urgently needed
A: A) In conditions of low tryptophan abundance, the trp operon will not be repressed by the trp…
Q: 9.1 Nematodes and Plathelmithes frequently inhabit the intestine of their hosts. Compare the…
A: Nematodes (roundworms) and Platyhelminthes (flatworms), although both are common parasites that…
Q: Question 19 Which of the following is FALSE in relation to CRISPR/Cas9? O Cas9 needs a PAM site…
A: Cas9 needs a PAM site consisting of an NGG sequence. True - The Cas9 enzyme requires a short…
Q: Experiment The effect of starvation on protein synthesis in Caenorhabditis elegans was studied in…
A: 1. At the top of the gradient the molecules that are detected by UV absorption are small RNA…
Q: Which one of the following measures CANNOT mitigate emissions of greenhouse gases in aquaculture?…
A: The objective of the question is to identify which of the given options cannot help in reducing the…
Q: Kingma et al. (2011) found that in the purple-crowned fairy-wren, most subordinate helpers at the…
A: The study by Kingma et al. (2011) revealed an intriguing observation in the purple-crowned…
Q: What is the simplest way to solve this? Please give me a step by step explanation.
A: Approach to solving the question:Detailed explanation: Note: 10×10−2=101−2=10−1…
Q: What enabled modern humans to colonize the world? Explain what Dan Lieberman means by "Brains and…
A: Approach to solving the question: I hope I was able to help you in elaborating on the topic. feel…
Q: List all the antibiotics in the above table that work through destroying the bacterial cell wall.…
A: In addition to the four described above, glycopeptide antibiotics target the bacterial cell wall.…
Q: QUESTION 6 A series of experiments were performed in Neurospora crassa in order to define the…
A: 1. Precursor and Intermediates:The precursor molecule is the starting point of the biosynthesis…
Q: Black men are more likely to get prostate cancer than other men. You are working on a prostate…
A: The objective of the question is to understand the various procedures involved in a prostate cancer…
Q: How are genes and enzymes related?
A: The relationship between genes and enzymes is a fundamental aspect of genetics and molecular…
Q: Urgently needed
A: The correct answer to the question regarding the technical advancement that allowed the products of…
Q: The new classification of the 3 Domains of life is based on: a) comparisons of the ribosome b)…
A: The objective of the question is to identify the basis for the new classification of the three…
Q: Which of the two benefits listed are both a "cultural service" as well as an "existence value"? Drag…
A: Let's identify the benefits that align with both "cultural services" and "existence value." These…
Q: The fossil record is biased because... Actually, this bias is only perceived; older eras had…
A: The fossil record is biased because fossilization is a rare process that requires specific…
Q: Location of headache is very relevant when exploring different types of headaches, explain why this…
A: The location of a headache can be a crucial clue in identifying the type of headache a person is…
Q: Which of the following are important for pulling chromosomes to the poles of the cell? Choose all…
A: The 3 answers are be: kinetochore MT, astral MT , and polar MT The explanation is simple.…
Q: What are some commonalities that exist among a majority of platyhelminths?
A: Despite the fact that they come in a wide variety of shapes and have a variety of lives,…
Q: Ischemic hypoxia is the result of: inability of the cells to use oxygen compromised oxygen…
A: - The inability of cells to use oxygen effectively can lead to ischemic hypoxia if they are unable…
Q: The French chemist Antoine Lavoisier was elected to the French Academy of Sciences for his discovery…
A: The question is asking about the discovery made by Antoine Lavoisier, a French chemist, for which he…
Q:
A: Approach to solving the question:1. Understand the context: The question is asking about the…
Q: BglII 6. You have a circular plasmid available, with a single RE site for BglII (A^GATCT). You…
A: Excising a Viral DNA Fragment from a Plasmid Using BglII: Detailed Explanation with ReferencesThe…
Q: Match each term to the best definition or description. Resiliency Species richness Biodiversity…
A: 1. Resiliency - High probability of recovery to the original state Resiliency refers to the ability…
Q: Number of individuals 10 8 6 4 64 2 0 6 On balloon vine fruits Beak- Museum-specimen average On…
A: Detailed explanation: Natural selection decreases beak length in soapberry bug populations: This…
Q: Neanderthals had large brain. True or false
A: The question is asking whether Neanderthals, an extinct species of hominids that were the closest…
Q: Case 1: In late August, a woman brought her 11 year old son, Michael, to their family physician…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: Q 7: What is the function of the nuchal crest? Which species have a pronounced one and what does…
A: Approach to solving the question: Comprehensive analysis provided as per the topic mentioned in the…
Q: Genetics Q7
A: Based on the information that has been provided, it is not possible to tell which children are the…
Q: Evaluating the positive and negative effects stress has on the human body 1. Does stress affect…
A: Approach to solving the question:Explained the queries on does stress affect reflexes and did based…
Q: Fill in the blank spaces
A: The ureters carry urine from the kidneys to the bladder. The bladder holds onto the pee until the…
Q: Male honey bees (Apis mellifera) die when they mate for the first and only time, achieving suicidal…
A: Sources: https://bmcecolevol.biomedcentral.com/articles/10.1186/s12862-016-0765-2…
Q: The questions are on the image
A: 1. Blood pressure readings include two different numbers, systolic pressure and diastolic pressure,…
Q: Are humans still evolving? Use an example from BBC's "How human culture influences our genetics."
A: Yes, humans are still evolving, and cultural practices can influence the direction and pace of human…
Q: Match the following terms with the best description. Question 7 options: The…
A: The objective of the question is to match the given terms with their appropriate descriptions.
Q: Based on the graph, which of the following tones would have the same perceived loudness as a 3000 Hz…
A: First, determine the contour line that contains the point where the frequency is 3000 Hz and the…
Q: Which of the following are regulators of Cdks? Choose all that apply. There are 3 correct answers.…
A: Cyclins: Cyclins are positive regulators of Cdks, which form complexes that regulate the cell cycle.…
Q: Identify the Genus
A: The figure shows the growth of Rhizopus in a lactophenol cotton blue stain culture.Domain:…
Q: Can you name the parts of the animal cellular?
A: La cellule animale, l'une des deux principales catégories de cellules eucaryotes avec la cellule…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X GSickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal hemoglobin is created from the codon GAA, which codes for glutamic acid while sickle-cell hemoglobin has the codon GUA, which codes for valine. This is an example of what type of mutation? * O Insertion O Silent mutation O Deletion O Substitution mutationFor each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.
- A certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center AccessibilityOriginal DNA Sequence: T A C G C A A A A A T C G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Mutated DNA Sequence # 1: T A C G C A A A A A T T G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Will there likely be any effects from the mutation? yes or no. Explanation: _________________________________ ______________________________________________________________________________________________What type of mutation is it? _________________________________________________________________Mutated DNA Sequence # 2: T A C G C A A A G A T C G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Will there likely be any effects from the mutation? yes or no. Explanation: _______________________________________________________________________________________________________________________________What type of mutation is it? _______________________________________________________________________What kind of mutation is present in the following DNA strand?: Wild-type: 3'-AGTCCCTGAAAT-5' Mutant: 3'-AGTCCCTGCAAT-5' Use the codon table if you need it. Answer choices: Deletion, Insertion, Missence, Silent I selected missence, but the answer is incorrect. Please help.
- -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTBelow are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-GlThis is a missense mutation. Include the ideas of transcription and translation. Compare the normal and abnormal strands.If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G