DescriptionPlease draw the structure of the 19 L-a-amino acids and proline in any form, as you prefer. You may want to use aletter-size sheet or larger, it's up to you.Guiding principle: You want to understand the differences among amino acids. Although you may want to onlydraw the R-group it's preferable to draw it along with the rest of the molecule (i.e., the Ca, the amino group andthe carboxyl group).Here are some examples (your drawings should not limited to the following styles):H₂CNH₂OHshutterstock.com-222977980AlanineHHProlineOH%%%lysinea alamy stock photoTryptophanHNNH₂shutterstock.com-1819000134QHCOOHH₂N-C- HCH ₂PhenylalanineH₂NNHdreamstime.comarginineNH₂OH

Amino acids serve as monomers of proteins and composed of a carboxyl group, an amino group, a…

Answered: Please draw the structure of the 19…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 19P

See similar textbooks

Similar questions

E. PROTEIN PRIMARY STRUCTURE ELUCIDATION. 1. Determine the primary structure of the protein described below. Write the final sequence using the corresponding three-letter code for each amino acid. Example: M-F-Y-R should be written as Met-Phe-Tyr-Arg Treatment with cyanogen bromide and sequencing yields the following peptide fragments: o D-M o R-A-Y-G-N o L-F-M Chymotrypsin digestion and sequencing yields the following peptide fragments: o G-N D-M-L-F o M-R-A-Y o o
01 Description Please draw the structure of the 19 L-a-amino acids and proline in any form, as you prefer. You may want to use a letter-size sheet or larger, it's up to you. Guiding principle: You want to understand the differences among amino acids. Although you may want to only draw the R-group it's preferable to draw it along with the rest of the molecule (i.e., the Ca, the amino group and the carboxyl group). Here are some examples (your drawings should not limited to the following styles): NH₂ OH Alanine H H O OH Proline lysine alarmy stock płwłos Tryptophan OH COOH | H₂N-C-H CH₂ Phenylalanine arginine
A. Write the structure of the following peptide at pH 5.0 and calculate its net charge at this pH. Asp-His-Tyr-Arg-Lys-Leu-Thr-Gln. Based on the pKa value of the ionizable groups. B. A polypeptide consisting only of L-glutamate residues (poly-L-glutamate) may have a random coil or helical structure depending on pH. Explain this behavior by indicating at what pH values the helical structure will be favored.
the resonance stabilization of the amide linkage has profound effects on protein structure. Which of the following are the direct effect(s) of this on protein structure? Select all that apply All six atoms around the bond (including the Co) lie on the same plane There is no free rotation about the peptide bond. The bond between the carbon and the nitrogen in the peptide bond keeps "flickering" between being a single bond and a double bond. The peptide bond is polar. The nitrogen in the peptide bond cannot accept a hydrogen bond.
Protein-4YU4 is given, choose a part of it (containing at least 30 amino acid residues), find the amino acid sequence (sequence in it), identify what functional groups the amino acid substitutes contain (carboxyl group and 2-position the Nitro group will form amide bonds, forming the covalent basic structure of the protein). What different interactions can occur between these functional groups? How will it relate to the spatial structure of the protein?
Asp-Gly-Lys-Glu-Ile-Phe Draw its full chemical structure as it would exist at pH = 7.0. Draw an arrow pointing to each peptide bond. Identify the net charge of the peptide and briefly explain how you arrived at this answer.
Determining the amino acid sequence in a protein usually in- volves treating the protein with various reagents that break up the protein into smaller fragments that can be individually sequenced. Treating a particular 11-amino acid polypeptide with one reagent produced the fragments: Ala-Leu-Phe-Gly-Asn-Lys Trp-Glu-Cys Gly-Arg Treating the same polypeptide with a different reagent pro- duced the fragments: Glu-Cys Gly-Asn-Lys-Trp Gly-Arg-Ala-Leu-Phe What is the amino acid sequence of the polypeptide?
I need help with drawing Hydrogen bonding between two tripeptide: Ser-Lys - Ser. In my class, we are required to give dash or wedge for the side chain R in the amino acid, and draw zig zag for the chain. In two separate drawings, can you draw one where it is the hydrogen bonding between the peptides backbone that connect the two tripeptides and the other is the hydrogen bonding between the side chains. Thanks
Chymotrypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: C-1 G-A-E-A-T-E C-2 G-K-V-G-A-H-A-G-E-Y C-3 V-L-S-P-A-K-T-N-V-K-A-A-W What is the sequence for the peptide? NOTE: Label the fragments when reconstructing the peptide chain e.g. for trypsin T-1, T-2 etc...
Identify and briefly describe three different PEGylation strategies you can use to PEGylate this peptide and draw the chemical structure of the resulting mPEG peptide conjugates
GABA (B) protein Need help answering questions about the GABA(B) protein. What is the primary structure Describe secondary structure (alpha-helix, beta sheet, and how many of each and what percent of the total protein)What is the tertiary structure (which should also show secondary structure)Does the protein have a quaternary structure, if so what is it?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified protein.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

Please draw the structure of the 19 L-a-amino acids and proline in any form, as you prefer. You may want to use a letter-size sheet or larger, it's up to you. Guidi