The figure below represents two DNA molecules, with polarities as indicated. The dashed block shows the region of DNA which you wish to amplify by PCR. In each case, indicate the positions of the forward and reverse primers you would use for the PCR, their polarities, and the direction of synthesis of the new strands with an arrow at the end of the primer. 5' 3' ------------------- 3' 3' 5' 5' ------------------------------ 5' 3'
Q: The traditional organization of the animal family tree of classification is based mostly on a. DNA…
A: Animal categorization into a family tree, or phylogeny, is based on comparable characteristics of…
Q: Let's suppose that a normal chromosome carries genes labeled A through /. The centromere is located…
A: A. Ignoring fertility issues, the individual with the inverted chromosome will likely be…
Q: which of the following models represents the genetic material that controls inherited traits
A: The DNA model is the model that represents the genetic material responsible for inheriting traits.…
Q: DNA molecule, which embodies genes, the hereditary units, is found in all living things. Science…
A: The steps involved in the production of human insulin in bacteria using biotechnology are : 1.…
Q: please answer all if possible i need it badly and asap make sure its correct
A: Which structure produces secretions that regulate blood sugar?Correct answer: c. FRationale:…
Q: Consider the following two nonhomologous wildtype chromosomes, where letters or numbers represent…
A: AThe rearrangement in scenario A is a tandem duplication, where the duplicated segment GH is…
Q: Why two strands of DNA are synthesized differently
A: Certainly! Let's break it down further.1. DNA Structure and Complementary Base Pairing:DNA, the…
Q: Which of the two benefits listed are both a "cultural service" as well as an "existence value"? Drag…
A: Let's identify the benefits that align with both "cultural services" and "existence value." These…
Q: 29) The doubling time in the bacterial growth cycle is measured during: a) Prodromal period b) Log…
A: 29 Measuring doubling time during the log phase of bacterial growth:The doubling time of bacteria is…
Q: Who discovered Bacterial small noncoding RNAs (sRNAs) ?
A: Bacterial small noncoding RNAs (sRNAs) are a differing class of RNA particles found inside bacteria…
Q: What is photosynthesis?
A: Photosynthesis is a biological process that occurs in green plants, algae, and some bacteria. It is…
Q: RELPs: A. are the same length for mutant and normal beta-globin alleles. b. determine the sequence…
A: Approach to solving the question: Read through each statement carefully and determine which ones…
Q: What part of a avocado plant is consumed by humans ? leaves? Roots? Stem?
A: 1. Avocado Tree Growth: Avocado plants start as seeds. Once planted, they grow into trees. It takes…
Q: Describe the formation and filling of soft gelatin capsule
A: Soft gelatin capsules are a commonly used oral dosage form in the pharmaceutical industry. These…
Q: What is the source of genetic variation in a population? Natural selection Mutation and sexual…
A: The question is asking about the sources of genetic variation in a population. Genetic variation is…
Q: The cytoplasmic granule of RNA and protein that reads the message in mRNA is a/an____________ .
A: In cells, different parts have specific jobs in making and controlling proteins. One important part…
Q: ons: On They will select and present a label for a pet food. They will identify on the label each of…
A: 1. **Main Display Panel** - This is typically the front of the package and includes the brand and…
Q: 2. The following questions refer to the pedigree chart in the figure for a family, some of whose…
A: To answer these genetic questions, I'll break down each scenario, analyze the pedigree charts, and…
Q: Can a DNA test tell you where someone is from and "who" (which ethnic group) they are from? Why or…
A: DNA tests have revolutionized our understanding of ancestry and ethnicity. These tests analyze an…
Q: QUESTION 5 For each of the following epigenetic modifications, describle how it affects…
A: Histone Acetylation:Effect on Transcription: Increases transcriptionMechanism: Histone acetylation…
Q: Please answer both thank you!
A: 11)Answer:Centrifuges are workhorses in blood analysis, utilizing the principles of circular motion…
Q: Which of the following would tend to DECREASE uptake of water by a plant root hair? Increasing the…
A: The question is asking which of the given options would decrease the uptake of water by a plant root…
Q: Contrast experimental and statistical analyses of cumulative selection in proteins.
A: Cumulative selection in proteins may be a crucial concept in molecular science that relates to how…
Q: Which of the following is not required for PCR? a. dNTPs b. bacterial plasmids c. carefully…
A: c1. DNA's building blocks are called deoxyribonucleotide triphosphates, or dNTPs. DNA polymerase…
Q: The French philosopher and mathematician Rene Descartes is credited with proposing arguments in…
A: The objective of the question is to identify which of the given ideas was not proposed by Rene…
Q: If the statement pertains to a threatened species, put an x in the threatened column. If the…
A: Detailed explanation: ThreatenedEndangered at least a few individuals are still presenta species…
Q: Describe Hemolytic Disease of the Newborn (HDN). Who is at risk for this disease? How can it be…
A: Certainly! Let's dive deeper into Hemolytic Disease of the Newborn (HDN) to understand its causes,…
Q: Define acidosis and alkalosis. Distinguish among respiratory and metabolic acidosis and alkalosis.
A: pH is the negative logarithm of H+ concentration in a solution. The pH range goes from 0 - 14. If…
Q: How has the wild version of a avocado plant been modified for human consumption ? what parts of the…
A: 1. Fruit size and shape:• The wild avocado plant naturally produces small, round to egg-shaped…
Q: The hypothetico-deductive method in science includes all of the following components except: logical…
A: The hypothetico-deductive method is a proposed description of scientific method. According to it,…
Q: Site A Site B Site A7 Species Site B = 5 Species *A*+* + Site C7 Species A Site C A vs B = 8 species…
A: the most accurate justification for saving Site C is that it contains the greatest number of unique…
Q: Evaluate the following ABG results. Determine whether the results are high, low, or normal.…
A: The objective of the question is to interpret the given Arterial Blood Gas (ABG) results and…
Q: Snuffle Snork TAC CAA AGA AAT ATT TAC ATG GGT GTT GTC TTC ACT TAC GAG GAT AGC CGC ATC TAC CAA CGA…
A: The objective of this question is to understand how DNA determines the traits of an organism. In…
Q: Which Renaissance artist and engineer produced sketches of tanks, submarines, helicopters, machine…
A: The question is asking for the name of the Renaissance artist and engineer who not only produced…
Q: When virulent bacteria invade an organism, they usually inflict damage to it. Can you assess the…
A: let's delve deeper into each of these mechanisms: Toxins Production:Exotoxins: These are proteins…
Q: Discuss why hypertension is considered the silent killer and why don't people take their high blood…
A: Why Hypertension is a Particularly Deceptive Threat: Hypertension, or high blood pressure, has…
Q: The axial skeleton can be divided into the skull, the vertebral column, and the __________.
A: The objective of the question is to identify the third major part of the axial skeleton, given that…
Q: Why are immature RBCs sometimes present in the blood? Question 7 options:…
A: The presence of immature red blood cells, also known as reticulocytes, in the blood is usually a…
Q: Imagine the unlikely case that the 11 individuals represented in the gel image above were truly…
A: Approach to solving the question: Detailed explanation:According to the numbering system given, the…
Q: Rainforest plants from which we extract medicines would be considered as a provisioning service.…
A: A provisioning service is any type of benefit to people that can be extracted from nature. Along…
Q: Which of the following statements is correct about the development of T cells? O After many cell…
A: T cells, including CD4+ T cells (T helper cells) and CD8+ T cells (cytotoxic T lymphocytes), develop…
Q: antigenic changes in viral pathogens promote disease?
A: Antigenic changes in viral pathogens are a central theme within the study of infectious illnesses,…
Q: Can u give me the correct answer
A: Solution: (information required was not provided. One possible food web is provided in the image…
Q: Why do positive feedback systems that are part of a normal physiological response include some…
A: Positive feedback loops are fundamental to physiological processes. This framework is fundamental in…
Q: Distinguish between dehydration synthesis and hydrolysis.
A: In science, numerous crucial processes include synthesizing and breaking down complex particles. Two…
Q: QUESTION 6 A series of experiments were performed in Neurospora crassa in order to define the…
A: 1. Precursor and Intermediates:The precursor molecule is the starting point of the biosynthesis…
Q: The table below shows four organisms and the biological processes each uses. Select the organisms…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: For the VWA locus, Sophie has two alleles, 16 & 18. She inherited the allele with 16 copies from…
A: Answer well explained above
Q: What is a gene
A: The objective of this question is to understand the biological concept of a gene.
Q: No need guidelines answers
A: let's take a methodical approach to dissecting the reasons for each of the genetic situations that…
Step by step
Solved in 2 steps with 1 images
- Your graduate advisor asks you to amplify the following sequence of DNA by PCR: 5’-ATACGCATTCGGACCAGGTCCTAA-3’ 3’-TATGCGTAAGCCTGGTCCAGGATT-5’ a. To ensure that the entire sequence above is amplified, what 6-nucleotide DNA primers should you add to your PCR mix? You order the primers listed above, but instead receive the following set of primers: 5’-CGCATT-3’ 5’-GGACCT-3’ b. What portion of the double stranded DNA molecule will be amplified after 10 rounds of PCR? Your labmate attempts to rescue your PCR reaction by providing you with the following set of primers: 5’-ATACGC-3’ 5’-TCCTAA-3’ c. What is the result of running the PCR reaction with your labmate’s primers? How many double stranded molecules of DNA will result from 10 rounds of amplification?For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGA
- PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCGȚAGCTATATGCTATCGTGACGTATCGGCGCATTAAȚCGGGATCGAT 3 50 3' TGGCÁTCGATATACOATAGCACTOCATAGCCGCGTAATTÀGCCCTAGCTÀ 5' 5' AGCTÇGCTAGCAGGAGAGAȚATCGÇTCATAGCTCCGATCGATGCCGCTAA 3 3' TCGAGCG ATCGTCCTCTCTÁTAGCGAGTATCGAGÓCTAGCTACGGCGATİ 5' 100 5' TATAGCTCTÇTGCGGATATÇGCATATACCẠ AGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACOCCTATAGCGTATATGGTTCCGGGATGČATACATCGAŤ 5' 5 TGCGTATATÇGGAGAGTCCTGGATATGGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCÁTATAGCCTCICAGGÁCCTATACCTCGAACTGACGTCTCTCGAGCT 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 3. ATACGCGAATCCGGCATATACGAACCCCTÍTCGAGATACATACGATACAC 5' 250 5' TGCATGTGCTATGCAACGTTCOGATTGCGȚAGCAGTAATAGCGCCGATTG 3 300 3'…You wish to amplify a segment of DNA from a plasmid template by PCR with the use of the following primers: 5’-GGATCGATGCTCGCGA3' and 5' -AGGATCGGGTCGCGAG-3'. Despite repeated attempts, you fail to observe a PCR product of the expected length after electrophoresis on an agarose gel. Instead, you observe a bright smear on the gel with an approximate length of 25 to 30 base pairs. Explain these results.PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCOȚAGCTATATOCTATCOTGACOTATCOGCOCATTAAȚCGGGATCGAT 3 3' TGGCATCGATATACGATAGCACTGCATAGCCGCGTAATTAGCCCTAGCTẢ 5 50 5' AGCTCGCTAGCAGGAGAGATATCGCTCATAGCTCCGATCGATGCCGCTAA 3 100 3' TCGAGCGATCGTCCICTCTATAGCGAGTAICGAGGCTAGCTACGGCGATİ 5' 5' TATAGCTCTCTGCGGATATÇGCATẠTACCAAGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACGCCTATAGCGTATATGGÍTCCGGGATGČATACATCGAŤ 5 5' TGCGȚATATÇGGAGAGTCCTGGATAT GGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCATATAGCCTCICAGGACCTATACCTCGAACÍGACGICTCTCGAGCİ 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 250 3' ATACGCGAATCCGGCATATACGAACCCCTITCGAĞATACATACG ẢTACAČ 5' 5' TGCATOTGCTATOCAACGTTC GGATTGCGȚAGCAGTAATAGCGCCGATTO 3' 300 3'…
- Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TTGCATCG 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA, and will this primer work as part of a pair to successfully amplify this fragment of DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. It will bind to the bottom strand on the left side of the fragment, and is suitable to amplify the fragment by PCR. b. It will bind to the top strand on the left side of the fragment, but it is unsuitable to amplify the fragment by PCR. c. It will bind to the top strand on the right side of the fragment, but it is unsuitable to amplify the fragment by PCR. d. It will bind to the bottom strand on the right side of the…Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TGCTATC 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. This primer cannot be used in the PCR process. b. It will bind to the top strand on the left side of the fragment. c. It will bind to the bottom strand on the left side of the fragment. d. It will bind to the bottom strand on the right side of the fragment. e. It will bind to the top strand on the right side of the fragment.For the STR site diagramed below, each repeat unit, represented by a rectangle, is known to be 5 bp long. The total length of the amplified PCR product for the chromosome shown below is 420 bp long. PCR product - 420 bo Primer Left STR STR STR STR Primer Right What size would the PCR product be for a different chromosome where there were only two tandem repeat units, instead of four? SHOW YOUR WORK.
- A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP ddCTP ddGTP What is the base sequence of the original fragment that you were given? 5'-TAAGCTGA-3' O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' O 5'-AGTCGAAT-3'Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be able to amplify this entire DNA fragment. Your answer must fulfill the following criteria: Design the primers so that they are each 7 bases in length. Please write out the sequence of these primers. Don’t forget to indicate the direction (polarity) of both ends of each primer. Note that only the polarity of one end of one of the template strands of DNA is provided below. Describe where the primer would bind (i.e. top or bottom template strand, left or right side of the DNA strand) Organize your response so that each primer, and associated information, is separated by at least one blank lineAssume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’