The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene?
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene.
DNA Template Strand: TACCACGTGGACTGAGGACTCCTC
1. What is the minimum number of DNA
2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' .
5' ATGGTGCACCTGACTCCTGAGGAG 3'
3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below:
3' TACCACGTGGACTGAGGACTCCTC 5' .
5'AUGGUGCACCUGACUCCUGAGGAG 3
4. What amino acids will this mRNA code for?
5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below.
6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? This change of DNA template is called mutation it is a type of deletion mutation
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
![Biology: The Dynamic Science (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
![Biology: The Dynamic Science (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)