The following pattern is observed in a multiple sequence alignment: substitutions are randomly distributed and many would change the amino acid residue, indels are 1 or 2 base pairs, and a relatively large number of the substitutions would introduce stop codons. What are the likely sequences? Exons tRNAs mRNAs Introns
Q: role of cytokines in the immune system? Why are they important for coordinating how the immune…
A: Delving deeper into the role of cytokines in the immune system and why they are crucial for…
Q: With the aid of a hand drawn diagram, briefly explain how T cells are primed or activated by B…
A: The objective of the question is to understand the process of T cell activation by B cells and to…
Q: Genetics Q6
A: The objective of the question is to identify the factor that determines how far DNA will travel from…
Q: Based on this tree, fill in the table below it, using 1 to indicate the presence of a trait and 0 to…
A: In the table provided, each row represents a trait (A, B, C, D, E), and each column represents a…
Q: You cross two wildtype (short-tailed) chipmunks, and collect a male offspring with a particularly…
A: Approach to solving the question: Detailed explanation: Examples:aApproach to finding a solution to…
Q: Choose the two correct answers. Eigen's equation predicts: Select 2 correct answer(s) How accurate…
A: Eigen's equation, named after the physicist and Nobel laureate Manfred Eigen, is a mathematical…
Q: The triplet UGA in mRNA causes: Choose ome a mutation in a protein translation to stop…
A: The question is asking about the role of the triplet UGA in mRNA during protein synthesis. mRNA, or…
Q: Pulmonary fibrosis is a restrictive lung disease that is characterized by deposits of scar tissue.…
A: Understanding the fundamentals of lung physiology—specifically, elastic recoil and compliance—is…
Q: Thrombocytosis, an elevated platelet count, occurs in some cancers and in qualitative disorders of…
A: The question is asking whether thrombocytosis, which is a condition characterized by an elevated…
Q: Are there any major differences between new world monkey skulls and strepsirrhines skulls? Take into…
A: Approach to Solving the Question:To comprehensively address the question, it's important to approach…
Q: Repeated white cell counts could be helpful in managing patients who are taking therapeutic agents…
A: The objective of the question is to determine whether repeated white cell counts can be beneficial…
Q: A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the…
A: To explain--M1: Met-Ser-Ser-Arg-Leu-Glu-GlyThis mutation involves the substitution of Pro with Ser.…
Q: 21
A: The question is asking us to determine the percentage of Thymine (T) in the DNA of an organism,…
Q: A spherical cell with the diameter of 10uMhas a protein concentration of 20 mg/ml. Determine the…
A: The following measures can be taken in order to ascertain the quantity of protein molecules that are…
Q: 44. The use of chemical agents to kill or inhibit the growth of microorganisms within their host’s…
A: The answer is d) chemotherapeutic, and here's a breakdown of why the other options are less…
Q: What are the key behavioral characteristics of the howler monkey? For example, preferred habitat,…
A: Howler monkeys, known for their loud vocalizations, are fascinating creatures with unique behavioral…
Q: ny pairs of sister taxa differ markedly in their numbers of extant species. In this chapter we saw…
A: Evolutionary science places a extraordinary deal of emphasis on the assortment of species inside…
Q: Following the spill of a mixture of chemicals into a small pond, bacteria from the pond are tested…
A: When a chemical spill occurs, particularly in a biologically dynamic environment like a pond, the…
Q: There are several instances which challenge the “one gene, one polypeptide” hypothesis. Describe TWO…
A: 1. Alternative splicing is a process that allows for the synthesis of numerous protein isoforms from…
Q: Describe the descovery of polymerase chain reaction (PCR), the components of the reaction and the…
A: The polymerase chain reaction, sometimes known as PCR, is a potent method in the field of molecular…
Q: RBCs are recycled constantly through the bone marrow. Question 11 options: True…
A: Production and Lifespan of Red Blood Cells (RBCs)Red blood cells (RBCs), also known as erythrocytes,…
Q: Please help. Research and describe a rapid antibody test used to detect a disease. Name of test…
A: The objective of the question is to provide a detailed description of a rapid antibody test used to…
Q: Which of the following mutations cannot be inherited by a person's biological children? A mutation…
A: The objective of the question is to identify which type of mutation cannot be passed on to a…
Q: Are there any major differences between new world monkey skulls and old world monkey skulls? Take…
A: Examples:Nasal Structure:Example of New World monkey: Spider monkey (genus Ateles) with broad, flat…
Q: True or False : CRISPR is a novel method for reliably amplifying gene products so that they can be…
A: Certainly! CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a groundbreaking…
Q: What does it mean for something to be selectively toxic? Which is more challenging to produce, a…
A: Due to the fact that it is required for medications and chemicals to only cause harm to the…
Q: Describe the processes and result of double fertilization.
A: In angiosperms, or flowering plants, double fertilisation is a special perspective of the…
Q: d.cyberhigh.org/Course.aspx?courseVersionid=232&unit=8&courseCode=biology-b&pid=536971&req-quiz8949&…
A: The principle that is NOT part of the Hardy-Weinberg Equilibrium is:In a finitely large, randomly…
Q: From DNA to Protein 3D what is the location in the cell or organelle where these processes occur,…
A: The process of protein synthesis, which involves the conversion of DNA to protein, occurs in two…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The correct chromosomal condition for one daughter nucleus at telophase of mitosis is diagram E.…
Q: Examine the Following key words and examples on the left. Drag the choice from the right that best…
A: The objective of the question is to match the given examples with the correct ecological succession…
Q: What
A: Patas monkeys, native to the semi-arid regions of Africa, are known for their remarkable speed and…
Q: What are the key behavioral characteristics of the indri? For example, preferred habitat, activity…
A: Indri indri are the arboreal lemur species. Indris are slender, long-limbed primates found in the…
Q: All of the following are TRUE of a vertebrate whose blood flows directly from the respiratory organs…
A: The question is asking us to identify the incorrect statement about a vertebrate whose blood flows…
Q: which of the following do researchers not need to use during vector cloning? a. a plasmid containing…
A: The objective of the question is to identify the component that is not necessary during the process…
Q: Examine the Following key words and examples on the left. Drag the choice from the right that best…
A: Primary Succession: This occurs when a community establishes itself on a previously uninhabited…
Q: What is the common ancestor of the Galapagos finches? What are the thirteen Galapagos finches? What…
A: Delving deeper into each aspect related to the Galapagos finches: 1. Common Ancestor: The common…
Q: Discuss the correct laboratory technique in using the centrifuge for qualitative analysis. Give two…
A: In labs, a centrifuge is a vital instrument that isolates diverse parts of a mixture, like fluids…
Q: Sequence data from OTUs are provided in the table below with values provided as (percentage distance…
A: To determine the phylogenetic tree using the UPGMA procedure, we follow these steps: 1. We start by…
Q: Band, Band Size, and what bands corresponds?
A: The image shows gel electrophoresis containing DNA fragments of various sizes. Gel electrophoresis…
Q: What is the significance of the complementarity of the two strands of DNA? It prevents mutations…
A: The question is asking about the importance of the complementarity of the two strands of DNA.…
Q: Why does hepatitis D only occur in patients with hepatitis B?
A: 1. Dependence on HBV for Replication: Hepatitis D virus (HDV) is a defective RNA virus that lacks…
Q: Pregunta 1 (1 punto) ¿Donde se encuentra el banco persistente de semillas? a En el suelo enterradas…
A: 1A) Translation of Spanish Text to EnglishOriginal Spanish Text:La respuesta correcta es a) En el…
Q: Nitrogen Content Assay Method II l is also known as? Micrometric Method Semimicro Method…
A: Deciding the nitrogen concentration of a material is fundamental within the region of chemical…
Q: Smudge cells are frequently seen in: Question 6 options: A) CLL.…
A: The objective of the question is to identify the type of leukemia in which smudge cells are…
Q: Genetics Question
A: The objective of this question is to understand the purpose and applications of three key tools in…
Q: DNA Fingerprinting A. What is an RFLP and where are they located within a gene? B. Why are RFLPs…
A: A. RFLP (Restriction Fragment Length Polymorphism):RFLP refers to the variations in the lengths of…
Q: What thoughts do you have on stigma & bias related to opioids, history of opioids, cause of…
A: The opioid crisis is a significant public health issue in the United States, with overdose deaths…
Q: Impedance technology is based on the fact that blood cells increase electrical conductivity in…
A: The objective of the question is to determine the validity of the statement: 'Impedance technology…
Q: Rouleaux is characteristic of which clinical condition? Question 4 options:…
A: The objective of the question is to identify the clinical condition that is characterized by the…
Is the answer mRNA or Exon?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- For the following sequence please design an 18 base pair REVERSE primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGWhat is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. Compare
- For the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGIn reversible terminator sequencing, how would the sequencing process be affected if the 3′-end-blocking group of each nucleotide were replaced with the 3′-H present in the dideoxynucleotides used in Sanger sequencing?Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full sequence atggaatataactctagtccacattccggtgcattttttccaatcgggtcagactcaggatccaaatctccttgtggcagcgtgaacgtcgtctcctctgatggagatggttcaggtgggaatgggagtga
- The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASEGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'If the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by the addition or deletion of three, six, or nine nucleotides? Would the reading frame be restored by the addition or deletion of three, six, or nine nucleotides?
- Calculate the expected number of times that a given 8-base-pair DNA site should be present in the E. coli genome. Assume that all four bases are equally probable. Repeat for a 10-base-pair site and a 12-basepair siteFor the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGG