The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you picked

The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you picked

Name: The queation on my assignment is select the description of an exon?the
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The queation on my assignment is select the description of an exon?the answers they give are:1. sequence of adenine nucleotides added onto the end of pre‑mRNA2. modified form of a guanine nucleotide added onto the end of pre‑mRNA3. coding portion of

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
write a correct terminology/word on column B that meet the description of column A COLUMN A COLUMN B 1. The site for protein synthesis where mRNA and tRNA meets. 2. Benign tumours or warts that might cause problems but do not spread to oyher parts of the body. 3. A nucleotide sequence that is complimentary to the mRNA codon. 4. A condition that depicts injury or diseased state of liver. 5. Term used to describe a process or condition which affects the general body function. 6. A type of virus that attacks the respiratory system to cause flue 7. The fluid found within the cell 8. A condition which describes harm, damage or impairment of kidney function. 9. To spilt a molecule or chemical bond. 10. The protein coat or shell of a virus
Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCG
Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
015347/quizzes/5825797/take 21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 3' untranslated region 5' untranslated region O folding into its functional shape O splicing out exons O adding a poly-A tail O removal of non-coding sections O capping the 5' end hp
Complete what is being asked and finally with the Genetic Code table, determine what specific amino acids will be finally formed. Given DNA strand 3’ T A C T A G C C T A C T G C G 5’ 1. The partner strand of the given _________________________________ 2. The mRNA strand formed _____________________________________ 3. The tRNA _________________________________________________ 4. The amino acids formed are __________________________________
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got about answering the question? (I do have the Codon table in my textbook) Consider a hypothetical protein that consists of the amino acid sequence arginine, phenylalanine and histidine. From this information, construct (1) the original DNA strand, (2) corresponding mRNA codons and (3) tRNA anticodons used to produce this hypothetical protein. (Only use 1 mRNA codon per amino acid.) In addition, be sure to include start and stop sequences where appropriate.
Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
Amino acid Large subunit of ribosome tRN4 Small subunit of ribosome mRNA Anticodon Submit Request Answer Chamon 4rl Torms of Use | Privacy Policy | Permiss
Match the correct answer to each blank. Note that each answer (1 through 4) can be used more than once Eukaryotic mRNAs Prokaryotic mRNAs Transfer RNAs Ribosomal RNAs 1. They contain exons and introns _____ 2. They are the template of genetic informtaion during protein synthesis ______ 3. They contain unusual or modified nitrogenous bases ______ 4. They display an anticodon each ______ 5. They have a cloverleaf structure ______ 6. They are synthesized by RNA polymerases ______ 7. They get charged with an amino acid by aminoacyl-tRNA synthetase ______ 8. They are capped on their 5' ends and polyadenylated on their 3' ends 9. There are 4 types of these in eukaryotes and only 3 types in E. coli ______
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.