The two strands of DNA are held together by. bonds, but can be denatured by and The nucleotides are linked together at backbone by bonds which are much stronger and require ATP driven enzyme to break and create them.
Q: Subunits óf called Nucleotides Nucleotides of DNA contain phosphate
A: A nucleotide is an organic molecule that is the building block of DNA and RNA. They also have…
Q: ATP is an example of which of the following. A pentose sugar An RNa nucleotide An amino acid with…
A: ATP stands for Adenosine Triphosphate. It is the principal molecule for storing and transferring…
Q: ...is always equal A, A + G... to T+ C. G C Purines Pyrimidines %3D [T]+[C]+[G]=100% #C Source of…
A: The Chargaff's rule says that in DNA there is always equality in quantity between the bases A and T…
Q: Nitrogenous bases in DNA and RNA? A) Adenine B) Cytosine C) Guanine D) All the above
A: Nitrogen bases in DNA nitrogen base or nucleobase is a nitrogen-containing compound that forms with…
Q: A DNA nucleotide has three components. Which one of the following is NOT a component of a DNA…
A: Introduction: The nucleotide is formed by the union of a phosphate group with a nucleoside. A…
Q: DNA is a hereditary molecule that is composed of a. deoxyribose, phosphate, and nitrogen bases b.…
A: A molecular structure characterized by the presence of two polypeptide chains forming a…
Q: Which is not a nucleotide base in DNA?a. adenineb. glutaminec. guanined. thyminee. cytosinef. all…
A: Nucleotides are building blocks of DNA and ribonucleic acid. The DNA has four nucleotides…
Q: If a DNA molecule is found to contain 20% G, the % of purine nucleotides would be (a) 20% (b)…
A: Chargaff was a scientist who has worked out an experiment that reported that in a double-stranded…
Q: Very carefully analyze each nucleotide structures (base and sugars) and identify the structure(s)…
A: Deoxyribonucleic acid or DNA is a type of nucleic acid present in the nucleus of the cell. It is a…
Q: The following strand of DNA is transcribed: 5'-GACCTCCGAATGC-3' Write the sequence of the…
A: Transcription: It is the process of synthesis of mRNA from double-stranded DNA by the enzyme RNA…
Q: i need help finding the right answers
A: The nucleotide polymers that are responsible for determining and the regulating the genetic…
Q: The ratio of _____ in DNA is 1:1 A) guanine to adenine B)…
A: Correct option is B adenine to thymine.
Q: Given DNA strand: 5' T G T T A G T C G A A T 3' Write its complementary DNA and its mRNA.
A: The DNA or deoxyribonucleic acid is the double standard helical macromolecule. It is the genetic…
Q: DNA molecules with complementary sticky ends associate by (a) covalent bonds (b) hydrogen bonds (c)…
A: DNA (Deoxyribonucleic acid) are the genetic material or genetic makeup of an organisms composed of…
Q: DNA nucleotide base pairings: Thymine pairs with ___________________________, Cytosine pairs…
A: DNA is a nucleic acid made up of several units of nucleotides joined end to end. A nucleotide is…
Q: When DNA is polymerized, a bond is made between the phosphate group of one nucleotide and of another…
A: DNA - Genetic material, Nucleic acid, consists of two polynucleotide chains. Polynucleotide -…
Q: Which of the options below is entropy driven the assembly of the DNA double helix. the folding of…
A: Entropy is the measure of disorder and randomness in a system. It is the thermal energy in the…
Q: Which of the following is/are not found in DNA? a. adenineb. uracilc. cytosined. deoxyribosee. both…
A: Nucleic acids are the polynucleotides which are held together by phosphate backbone. Generally, it…
Q: Both DNA and RNA are sensitive to alkaline hydrolysis. However, RNA is more sensitive to alkaline…
A: The phosphodiester link in the sugar-phosphate core of RNA is disrupted during RNA hydrolysis,…
Q: If the sequence of one strand on DNA is… CTA GCT CCA its complementary strand will be… _____________
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: DNA ultimately contains the instructions for the assembly of:a. proteinsb. polysaccharidesc.…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: A biological molecule that contains a base pair that holds information molecules for the cell?*…
A: Amino acids are required to make protein molecules. Protein is a heteropolymer of the twenty…
Q: The nucelotides in a single strand of DNA or RNA are connected bya type of covalent bond called (n)_…
A: DNA is made up of many Nucleotides. Each nucleotide is made up a sugar molecule (either ribose in…
Q: The function of DNA is to _______ while the function of RNA is to ___________. store information…
A: The two main types of nucleic acids found in all living cells are DNA and RNA. Both are made from…
Q: A D 3. Nucleic acids play what role in cells? O Nucleic acids are the powerhouse of the cell. O They…
A: Nucleic acid is a vital and important macromolecule which have mainly 3 functions, create, encode…
Q: are stacked upon each other to make up strands of DNA.
A: DNA is a self-replicating material that is present in nearly all living organisms as the main…
Q: Both DNA and RNA are made of subunits or building blocks called _______
A: Both DNA and RNA are composed of some building blocks and these RNA and DNA are the polymers of…
Q: The carbon sugar found in DNA is called and the four nitrogeneous bases are and
A: DNA is a nucleic acid more stable than RNA. Hence it is the genetic material for most organisms. DNA…
Q: Denaturation of proteins results in * Disruption of primary structure Breakdown of peptide bonds…
A: Proteins' capacity to fold into their precise functional forms is influenced by several factors such…
Q: Nucleotides, in a polynucleotide sequence, contain phosphate groups bonded to the: C3 and C3' atoms…
A: Nucleic acids are the macromolecules that contain the genetic information of living organisms. The…
Q: What binds the phosphate group and sugar of adjacent nucleotides in the DNA molecule? O non-covalent…
A: The self replicating by molecules that are present in the chromosomes and carry genetic information…
Q: DNA & RNA Structure Base pairs- What the backbone is made up of - How many strands each molecule has…
A: Hi! Thank you for your question. As you have posted multiple questions and have not mentioned which…
Q: A gene is a piece of DNA that codes for a protein. Genes are transcribed into mRNA and are on the…
A: DNA => Transcription => mRNA => Translation => Protein. Given: A DNA sense strand…
Q: DNA bound with to form complex structure called chromatin * Carbohydrates Lipids Vitamins None of…
A: The DNA conveys the cell's hereditary guidelines. The significant proteins in chromatin are…
Q: Which of the following rows is true regarding transcription and translation? Select one: a.…
A: Transcription is a process of formation of mRNA from DNA with the help of enzyme RNA polymerase. The…
Q: DNA is chemically stable than RNA due to the on
A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…
Q: A key function of ________ is to store energy. a. fats b. proteins c. nucleic acids
A: Macromolecules are large molecules or polymers which are formed from the simple monomers which are…
Q: The 3 components of a nucleotide (DNA/RNA) are DNA looks like a twis ted ladder. The sides of the…
A: DNA= deoxyribonucleic acid and this is found in the mitochondria of cells and is encoded in the…
Q: Gene expression refers to the molecular structure of DNA. the process by which protein manufactures…
A: A gene is the basic physical and functional unit of heredity. Genes are made up of DNA.
Q: There are many functions of enzymes that are essential for cellular processes. A ligase is used to O…
A: NOTE:- "As you have posted multiple questions under one, we will solve the first part for you, to…
Q: The chemical combination of ribose and one of the phosphate group results in formation of a…
A: Nucleotides in a cell are known as the building blocks. Their functions entail cell signalling,…
Q: Adenine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately, what…
A: Introduction According to Chargaff's rules, DNA from every species of organism should contain a 1:1…
Q: What chemical groups connect the 3' end of neighboring sugar units in DNA? * Ribose Phosphate…
A: DNA (deoxyribonucleic acid) is the genetic material in living organisms. It is a polymer whose…
Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…
A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…
Q: The protein illustrated below was isolated from a superhuman being. Scientists theorized that it was…
A: Proteins are made up of small units or building blocks. These units are called amino acids.…
Q: In DNA, nucleotide bonding forms a compound with a characteristic shape known as a(n) ________.a.…
A: To determine: To determine the compound's characteristic shape that is formed by nucleotide bonding…
Q: Chemical reactions performed for metabolism are mostly performed by _______________. tRNA mRNA…
A: The central dogma states that how gene is expressed into proteins.
Type in response to each notes/questions
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from ______. a. phosphate-group transfers from ATP b. DNA polymerase c. the nucleotide itself d. a and cWhich of the following statements about DNA replication is INCORRECT? It is powered bythe hydrolysis of ATP. Each strand withinthe DNA double helix is used as a template for synthesis of a new strand. It requires that both strands of the double helix be separated from each other. It proceeds withthe addition of new nucleotides to the 3′ end of a growing DNA strand. It begins atmultiple origins of replication sites along eukaryotic chromosomes.DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & III
- In DNA Replication, what is the function of Primase: works to connect discontinuous parts of DNA such as the nicks created by gyrase and the okazaki fragments O Synthesizes RNA on a DNA template to provide an available 3'-OH group to continue with DNA synthesis O binds at the origin and begins to unwind the helix O bind near the origin to maintain the complementary sequences of DNA from reforming the helical structurehe bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′Labeling DNA Replication Directions: Drag the lahels from the left tn corrary derti theinats of ar=rlicating strandarA 24 Newly Created Strand of ONA Replication Carke Original DNA Strand Replication Direction of Origin of Replication Directions: Bolow is a more in-depth look at a replication bubble. A.l of the psrts are still tne came, but
- If a mutation occurred that prevented single stranded binding proteins from binding, the result would be: O Replication would not be initiated O DNA would be synthesized on the leading strand, but not the lagging strand Replicating would be initiated, DNA would unwind, RNA primers would be laid down, but DNA polymerase would not bind O The newly synthesized RNA would not be able to leave the DNA template Replication would be initiated, but RNA primers would not anneal to the DNADNA replication occurs by adding (Note: NTPS = nucleotide triphosphates; dNTPs = deoxynucleotide triphosphates) DNTPS to the 3' end of the template strand NTPS to the 3' end of the daughter strand DNTPS to the 3' end of the daughter strand DNTPS to the 5' end of the template strand NTPS to the 5' end of the daughter strandWhich protein is needed to lay down a segment of RNA complementary to the DNA before replication can begin? O RNA pelymerase NI O primase O helicase O DNA polymerase lII O topoisomerase
- Given the active site diagram below, please identify the residue participating in a charge-charge interation. HO OH HN OH 5 ΝΗ *HN ΝΗ OH O Zn²+ 2 4 5 3 1 2 NH 3A DNA polymerase has everything it needs for extension, EXCEPT for RNA primers. What is the most likely consequence of this? No DNA replication will occur at all O DNA replication will occur much more slowly O Replication will be highly error-prone O Only one DNA strand will be replicatedDNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLY