Q: What are morphogens, exactly? Explain how they affect the patterning of tissue throughout embryonic…
A: Pattern formation is a development process by which the cells acquired different identities…
Q: What parts are persistent throughout the development of the embryo? Why are these present in all the…
A: Answer
Q: In a newly fertilized egg, the vitelline layer O secretes hormones that enhance steroidogenesis by…
A: In Sea urchin, a capacitated sperm first crosses zona pellucida layer then it passes through…
Q: The photo on the left shows an early frog embryo after three mitotic divisions of a fertilized egg.…
A: Introduction: Once the female frog has laid its egg, the male frog releases its sperm in the water…
Q: Why does the dispersion or contraction stage of the developmental cycle assume a complex character
A: Family development is a notional methodology for the orientation of the research and set an abstract…
Q: The cells that pull the archenteron through the blastocoel in the sea urchin are _____ cells called…
A: The early stage in the development of the embryo is referred to as gastrulation. Gastrulation is a…
Q: Animals and plants both have diploid and haploid cells. How does the animal life cycle differ from…
A: The alternation of generations is the alternation of a sexual phase and an asexual phase in the life…
Q: hat parts are persistent throughout the development of the sea urchin embryo? Why are these present…
A: A multicellular animal arises from a single cell a fertilized egg. During development ,the cell…
Q: How many functional eggs (ova) result from one oogonium? A. 1 and 3 polar bodies B. 18…
A: In sexually reproducing organisms haploid gametes are produced. Female gametes are called eggs…
Q: Where is the egg found in seed plants?
A: Seed plants are a group of plants. Gymnosperms and angiosperms form the group. Their seeds have…
Q: lame specific structure "A" Ovary lame specific structure "B" anther A-
A: The given figure it of a flower. Flower is considered to be a reproductive organ of the plant. If…
Q: Why are blastomeres in the pigmented part of the egg smaller and more numerous than in the…
A: The other terms associated with developmental biology include embryogenesis or embryology. This…
Q: Fill in the blank: A human offspring is called a(an) ___________________ until the end of the…
A: The development of human offspring takes around nine months. The development involves four stages.…
Q: iv. Two nuclei cells in Stage W will be fertilized by two male gametes. State how the two male…
A: Blooming plants replicate physically through a cycle called fertilization. The blossoms contain male…
Q: 26. What stage is this? 27. What stage is this? 28. What stage is this? A C E F 29. What stage is…
A: In most animals, the sperm is the haploid male gamete that fuses with the haploid female gamete or…
Q: Draw and label the parts of frog neurulation stages as seen in x.s. and w.m. preparations.
A: Neurulation in frog is a folding process in which the vertebrate embryos which essentially manages…
Q: What is the evolutionary significance of parthenogenesis in the class insects?
A: Parthenogenesis is a type of asexual reproduction in which the offspring develops from unfertilized…
Q: At this stage of embryogenesis, the plant embryo forms eight cells. In Arabidopsis thaliana, it is…
A: Embryogenesis of a single cell gives rise to a living multicellular organism. The embryo formed from…
Q: In frog neurulation the notochord _______ the formation of the _______ in the ectoderm next to it.…
A: ANSWER) (a) expresses, neural plate
Q: Consider the similarities and differences in the reproductive cycles (haplontic, diplontic, and…
A: All these life cycles are based on the haploid and diploid phases. This is called alternation of…
Q: What is the difference between direct and indirect development?
A: Development refer to the process of the formation of the adults from the progeny stage. There are…
Q: In embryos with spiral cleavage the 4d cell gives rise to which germ…
A: INTRODUCTION Mesoderm It is a germ layer formed during gastrulation. Present between ectoderm and…
Q: In mammals, primordial germ cells migration ends when they reach the _________________ posterior…
A: Primordial germ cells (PGCs) are highly specialized cells that act as precursors of gametes, which…
Q: why do the embryos of different species resemble each other?
A: The embryo is an early stage of development in multicellular organism (from fertilization to start…
Q: How much genetic information is found within gametes (eggs and sperm)? A. Each gamete contains one…
A: There are two types of gametes male and female.Male gametes are called as sperms which are formed…
Q: What is one of the ethical issues related to using embryonic stem cells? O A. Embryonic cells are…
A: Embryonic stem cells (ESCs) are collected from early-stage embryos i.e a group of cells that produce…
Q: Which choice below shows a correct order of events during development? Gastrula, blastula, neural…
A: Embryonal development consists of many stages and involves Cellular division Cellular…
Q: Give one possible function of the observed phenomenor
A: In the diagram, the organism is a sea-cucumber.
Q: an egg cell were treated with EDTA, a chemical that binds to calcium ions: The acrosomal reaction…
A: Physiologically, the acrosomal reaction requires presence of calcium ions for the reaction to…
Q: The embryo found in the mosses, ferns, pines, and flowering plants is; Haploid Diploid Neither
A: Embryo It is early stage of development of a multicellular organisms.
Q: For each embryonic tissue type, write one organ or differentiated cell type that is derived from…
A: Introduction:- The endoderm (inner layer), ectoderm (outer layer), and mesoderm (middle layer) are…
Q: Is parental care of a species a factor that affects embryological development? If so, how?
A: Embryological Development -- Embryological Development also called as Embryogenesis a complicated…
Q: The developmental pattern of C. elegans is said to be mosaic because (a) development is controlled…
A: Introduction:- The nematode worm Caenorhabditis elegans is perfect for understanding the genetic…
Q: The grandfather has hairy-eared son. His son married a girl who gave birth to a boy. What are the…
A: Introduction: The pedigree refers t the family tree, which is drawn with genetic standard symbols.…
Q: How many are in each stage?
A: Hi! Thank you for the question. It seems some of the cells aren't properly visible. So, I am…
Q: Question #1 What is importance of pharyngeal pouches in development? Question #2 What duct empty…
A: Bile is a type of fluid that is made and released by the liver. Bile is stored in the gallbladder.
Q: Give an analogy on how the concepts of determination and differentiation are seen in personal events…
A: During the early embryonic development , the cells are said to be totipotent because of their…
Q: mammals, primordial germ cells migration ends when they reach the _________________ posterior…
A: Premordial germ cells are only means of genetic transmission between parent and offspring.…
Q: IDENTIFICATION (Developmental Biology) Question #1. Refers to the arrangement of the mitochondria,…
A: Developmental biology deals with the study of development of multicellular organisms from single…
Q: By looking at the picture above, describe the events that take place during fertilization up to the…
A: Fertilisation is q process of fusion of male and female games resulting in the formation of a…
Q: What evolutionary changes occur to the egg covering between external and internal fertilization?…
A: Life first evolved with external fertilisation and later on internal fertilisation. Since, external…
Q: Embryos with cleavage pattern depicted in panel B exhibit mosaic development. B A) True B) False
A: Embryo In developmental biology, the early stage of multicellular organism that is form by…
Q: What process is occuring indicated by the letter A Name the strcuture indicated by the letter B Name…
A: The given diagram shows the life cycle of the angiosperms. Angiosperms are the flowering plants in…
Q: Label the parts of the ovule in the free-nuclear- and mature stage. Indicate the ploidy of the…
A: Labeling of the parts of the ovule in the free-nuclear- and mature stage is done below:
Q: What is embryological studies?* O the study of the development of an embyo O the study of plant and…
A: Fertilization is a process of fusion between the male gametes (sperm) and the female gametes (egg).…
Q: It appeared, then, that something in the region of the gray crescent was essential for proper…
A: The amphibian eggs, when divided into two blastomeres along the plane of first division, the cells…
Q: Embryo Gene 1: R Red (or purple) aleurone, dominant Colorless aleurone, recessive Gene 2: Colorless,…
A: 1. For answer 1 determine all the genotype in F2 generation in this figure. 2. Predict the color…
What similarities do the illustrations have? What are the differences? What trends do you see from stage 1 to stage 3?
![Fish
Chick
Pig
Calf
Human
Stage 1
6
11
Stage 2
15
12
Stage 3
10](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F953c0bb1-8a40-40cb-91f1-23f88528cce5%2F67588cc0-0a61-44c8-b955-f8ca87d60f39%2Fz6uv5p_processed.png&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- ScX O 2020/ X Chapt O Pla + x ti Grades x - Micros x Attach x 2 Edpuz x (1) Dia x A quizizz.com/join/game/U2FsdGVkX19u5PV2q0828jgMm6BEgGF6fEPUbfvRFnusX%252BvbgoJX50wVADbL6X.. Johnson - Bo.. A Classes Course stream ti Planner - ProgressB. Holt McDougal Onli. G snake - Google Sear. O YouTube C 2KMTCentral | NBA A Actively Learn 1/7 Streak Whose research suggested that DNA was helical? Chargaff Watson Crick FranklinNo explanation needed just answer to MCQPart D E F urgently needed
- TACCCCGAGTCCCTGGCGTTAAAACAGTGCCGAATCX + ua/la/launch/49049728/45384876/aHR0cHM6Ly9mMi5hcHAUZWRtZW50dW0uY29tL2xlYXJuZXItdWkvc2Vjb25kYXJ5L3VzZXItYXNzaWdubWVudC800TA0OTC 1 Select the correct answer from each drop-down menu. In an experiment, a scientist decides to study the effect of exercise on cholesterol levels in people. He studies two set of people-those who exercise every day for an hour and those who don't exercise at all. In this case, the statement that people who exercise for an hour may have lower cholesterol levels is ✓. To test this statement, the scientist would measure cholesterol levels in exercisers and non-exercisers. The cholesterol levels would be Reset Next 6 ←Huhzuususuususuususbelow check question