Which of the following include the correct order of phases of a typical bacterial growth curve? log, lag, stationary, decline/death lag, log, stationary/decline, death lag, log, stationary, decline/death log, lag, decline/stationary, death

Which of the following include the correct order of phases of a typical bacterial growth curve? log, lag, stationary, decline/death lag, log, stationary/decline, death lag, log, stationary, decline/death log, lag, decline/stationary, death

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter26: Prokaryotes: Bacteria And Archaea

Section: Chapter Questions

Problem 2ITD: The proteobacteria in the genus Pseudomonas are important spoilers of food. The rate at which food...

See similar textbooks

Related questions

Q: ATP energy for generates produce some produces many cellular work (a) (b) chemiosmosis has three…

A: Every living organism performs cellular respiration that is responsible for the breakdown of…

Q: *Cystic fibrosis is a rare autosomal recessive condition. A phenotypically normal man whose father…

A: Mendel proposed three laws based on his research. His research provided a picture of the independent…

Q: In Drosophila,, the curled mutation (cu, chromosome 3, position 50.0) results in wings that curl up,…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Which codons do not have a matching tRNA? Select all that apply O UAA O AUG OUGA UGG OUAG

A: Transfer RNA (tRNA) is defined as a subclass of RNA molecules which is essential for the translation…

Q: Place the following terms or examples with the correct category. Glycosaminoglycans Chondroitin…

A: Glycosaminoglycans, proteoglycans are the components of cell matrix and cell surfaces. These help in…

Q: Sugar residues that are attached to proteins embedded within the plasma membrane, that play a role…

A: The question pertains to a fundamental aspect of cell biology and the structure of the plasma…

Q: el Which of the following is a comma-shaped, Gram-negative bacterium that acts as a predator on…

A: Bacteria are relatively simple, microscopic and prokaryotic organisms which lack nucleus and other…

Q: 18. During cytokinesis, plant cells form a a. Cell furrow b. cleavage furrow c. cell plate d.…

A: Cytokinesis is the final stage of cell division in which the cytoplasm splits between the two newly…

Q: For each of the following, identify what characteristics of a species male and female karyotype…

A: Answers and Explanation : 1. Genic : In this case, the ratio of number of X chromosomes to the…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: Impulsiveness: A) has been linked to functional and structural changes in the brains of drug…

A: Impulsivity is a complex trait that is influenced by a variety of factors, including genetics, brain…

Q: Given the expected phenotype probability that you determined above, what is the minimum number of…

A: To calculate the expected number of offspring with the AB phenotype, you can use the product rule of…

Q: How does uniport transport (facilitated diffusion) compare with simple diffusion? O Uniport…

A: Simple diffusion is the passive movement of molecules or ions from an area of higher concentration…

Q: This is a picture of a plant that grows in the tundra with the common name arctic willow. Plants…

A: The tundra is an ecosystem characterized by extremely cold temperatures, low precipitation, and a…

Q: Name and describe 5 properties of cancerous or tumor cells from patients(in vivo) and of cancerous…

A: Cancerous cells are abnormal cells that grow uncontrollably, invade surrounding tissues, and can…

Q: A female fruit fly with vermilion eyes and normal wings is crossed with a male with normal red eyes…

A: This question involves the principles of genetics and inheritance, specifically focusing on the…

Q: What is a potential reason as to why intracellular calcium levels increase even after a…

A: Neurons are the cells of the nervous system that are responsible for the generation and conduction…

Q: simple squamous transitional epithelium stratified squamous (keratin) simple columnar with cilia…

A: The cell is the basic functional unit of all biological entities. These cells combine to make an…

Q: Comparing the two phylogenies below, we can conclude that -Reptiles -Therians -Platypuses…

A: A phylogenetic tree is a diagram that shows how different species, life forms, or genes have evolved…

Q: Refer to the graph. current Ion current Inward Outward current A researcher conducts a voltage clamp…

A: This question is about a voltage clamp experiment conducted on a giant squid axon. The voltage clamp…

Q: What is the dilution factor for tube #4? 1ml O 10^-1 10^-7 10^-6 10^-5 10^-4 9 mL ↓ 0.1 mL Plate 1…

A: In microbiology and cytology laboratories serial dilution process is routinely used to calculate the…

Q: In active membrane transport

A: In the active transport, substances (e.g. ions, glucose, and amino acids) move across a membrane…

Q: Birds undergo prolonged migratory flights, with some birds flying constantly for hours to days at a…

A: The phenomenon of migration can be described as the regular movement of individuals or groups of…

Q: The average heterozygosity of the European Iguana from 1700 was 0.0567 across many loci. Looking at…

A: Heterozygous refers to a genetic condition where an organism possesses two different versions of a…

Q: Based on these graphs, and assuming head raises of European finches helps watch for predators but…

A: The first graph (a) depicts the relationship between the total head raises of the flock per minute…

Q: The students in Ms. Potter's class are making drawings to represent system models of a mouse. Which…

A: The best describes what they should draw as the boundary of the system is : 3- exterior surfaces of…

Q: Which of the following strategies are used by biological systems to ensure an enzymatic reaction…

A: Enzymatic reactions in biological systems frequently need particular tactics to guarantee their…

Q: Calculez: 0.02cm+3.72mm+0.024m+230µm. Give the answer in mm (do not round off your answer, write…

A: A micrometer, often called a micron, is a unit of length in the metric system, symbolized as µm. It…

Q: O Intron O Exon O 5' Cap O Poly A tail O Promoter O Terminator

A: These are the essential components of the genetic code that encodes for building proteins and…

Q: Senescent cells usually undergo marked changes in chromatin structure characterized by densely…

A: Cellular senescence is the loss of a cell's capacity to divide and function normally.This can be a…

Q: 4) Listen are channels between cells that aid in communication Odesmosomes gap junctions Tulear…

A: Here, the correct answer is B) Gap junctions.

Q: Find a image of life cycle of Zygomycota and Ascomycota: The image of Life Cycle must have: •…

A: Fungi are eukaryotic microorganisms. This can be divided into following classes - Ascomycota and…

Q: Describe how the heart as a muscle does its job of pumping blood. What happens if the cardiac muscle…

A: The heart is primarily composed of cardiac muscle tissue, which contracts rhythmically to pump blood…

Q: it might happen to your red blood cells if your blood solute concentration began to fall rapidly…

A: Blood performs many functions in our body. The main components of blood are red blood cell, white…

Q: You have been researching the biodiversity of different species of lizards in the Florida…

A: To calculate the biodiversity index, we need to divide the number of species by the total number of…

Q: Following is a list of constitutents found in eukaryotic cells. Rank each constituent in order, from…

A: Large and sophisticated creatures are made up of eukaryotic cells, which have a nucleus surrounded…

Q: ease select the diseases that are often caused by S. pyogenes. Check All That Apply impetigo…

A: Group A Streptococcus, also known as S. pyogenes, can lead to several illnesses.

Q: A) carbon-hydrogen bonds B) NAD+ C) CO2 OD) NADH OE) ATP

A: According to the guidelines of Bartleby,Since multiple questions are posted, the expert can only…

Q: Imagine you are a college student volunteering for a nonprofit cancer organization that houses…

A: Cancer is a condition characterized by uncontrolled cell growth and division in the body. These…

Q: Discuss biofilms and their relevance to infectious diseases

A: According to the guidelines of Bartleby,Since you have posted multiple questions, the expert can…

Q: Tackle the question of how we determine membership in a particular species?

A: Definition A species is a group of organisms having similar features. A particular species has…

Q: Consider a gram negative pathogen isolated from marine mammals. This pathogen is subjected to a…

A: Here in this question we are given certain characteristics and on the basis of it we have to…

Q: can derive nourishment from eating clothing made of natural fibers such as wool (which is rich in…

A: Clothes moth larvae possess a unique ability to nourish themselves by consuming clothing made of…

Q: In peas, the yellow allele is dominant over the green allele. A plant with yellow peas was crossed…

A: In this cross, the dominant allele for yellow peas is represented as G, and the recessive allele for…

Q: Determine the % inaccuracy by calculating the percent error of the micropipette at the set volume of…

A: In order to solve the issue, real weight measurements must be compared to the predicted volume using…

Q: In dosage compensation, do males sometimes overcompensate or is it always Barr body X-chromosome…

A: Dosage compensation is the process by which the organisms equalizes their genetic expression between…

Q: This graph shows the relationship between the number of individuals in a minnow school and how often…

A: The graph is about the minnow size and attacking predators. The graph shows the relationship between…

Q: his is an image of a long bone. Identify "3" 1 4 5 6

A: Answer :- In these questions, we are asked to identify specific parts of a long bone from provided…

Q: The pathway that governs sex in C. elegans is shown. Based on our understanding of this, what…

A: A deficiency in xol-1 function is anticipated to result in an "intersexual" phenotype.Sex…

Q: The snapdragon flower in Tennessee and Alabama are both white. When these two strains of snapdragon…

A: In complementary gene interaction, two different genes (in this case, alleles) interact in a way…

Concept explainers

Population Growth

R and K Selection

R and K selection are concepts in ecology used to describe traits in the fluctuation of a population or population dynamics. For example, they describe the life-association traits between parent and offspring, such as quantity or number of young ones born at a time, quality of parental care, the age to maturity, and reproductive effort.

Question

Which of the following include the correct order of phases of a typical bacterial growth curve?
log, lag, stationary, decline/death
lag, log, stationary/decline, death
lag, log, stationary, decline/death
log, lag, decline/stationary, death

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Microbial culture

VIEW

Step 2: Phases of the bacterial growth curve

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What type of overall bacterial growth does the following graph represent? aggregated logistic differential exponential
Describe the following phases of the bacterial growth curve and draw them out:a. Lag phaseb. Logarithmic phasec. Stationary phased. Decline/death phase
Which one of the terms below is NOT a stage in the typical growth curve of a bacterial cell under ideal conditions in culture? O Exponential phase Lag phase Stationary phase Leg Phase Death Phase
How would a limited food supply affect the bacterial growth curve? The lag phase would be longer than if the food supply were unlimited. The log phase would be shortened. The culture would not enter a death phase but would remain stationary indefinitely. The death phase would be shortened.
Describe the importance of the nitrogen and carbon cycles and the role of microbes in their maintenance. Discuss biofilms and their relevance to infectious diseases. Discuss population growth and the phases of a typical bacterial growth curve. Describe generation time for a bacterial population Explain how bacterial growth correlates to disease. Describe how environmental changes can alter the shape of a growth curve. Categorize microbes based on their preferred environmental niches (pH, temperature, oxygen and salt). Identify the biological properties that allow different classes of microbes to grow in extreme environments.
What is the equation that represents the mass balance of the exponential phase of bacterial growth? Name each variable.
make a graph out of this t = time of growth of bacteria in mins y = number of bacteria
Researchers discover a new strain of a previously known bacterial organism and need help understanding properties related to it's bacterial growth patterns. The new strain is lethal to humans and is found to be increasingly deadly in arctic climates. Researchers have also provided the following chart of plate counts: Colony |(minutes) Forming Units by ml (CFU/ml) Time 20 15 20 30 340 45 50,009 60 175,168,185 90 175,168,189 120 175,168,002 150 423,237 210 505 | 270 5 a) Create a bacterial growth curve with log values of CFU/ml on the Y-axis andthe time on the x axis. b) Indicate the different phases of the growth curve on your plot. c) Determine the growth constant value (k) and the Generation Time value (G). show calculations 8 8
A bacterium is inoculated into a medium containing two carbon sources, one of which is the bacterium’s preferred carbon source. The resulting growth curve shows two lag phases. Explain this phenomenon. What is this type of growth called? Include a diagram of what the growth curve would look like and indicate the usage of each carbon source.
In which phase would you find the highest resource to bacterial cell ratio? Pick one Stationary Phase Log Phase Lag Phase Death Phase
The generation time of a bacterial culture that produces two generations per hour is: a. Equal to that produces three generations per hour bLesser than that produces five generations per hour than that produces three generations per hour Lesser than that produces four generations per hour Greater than that produces three generations per hour
For the bacterial growth curve below in which phase does the number of cell divisions equal the number of cell deaths? Log of number of bacteria 0 Lag Phase Intense activity preparing for population growth, but no increase in population. lag 2019 Pearson Education, Inc. log Log Phase Logarithmic, or exponential, increase in population. stationary Stationary Phase Period of equilibrium; microbial deaths balance production of new cells. The logarithmic growth in the log phase is due to reproduction by binary fission (bacteria) or mitosis (yeast). 5 Time (hr) Death Phase Population is decreasing at a logarithmic rate. death Staphylococcus sp. 10 None of the other four answers are correct Log Phase Stationary Phase Death Phase Lag Phase