Which of the following RNA sequences is an inverted repeat and can form a stem-loop structure?     What is the correct option from the choices below? GGUAGGCAUUACGGAUGG GGUAGGCAUUAGCCUACC GAGAGAGAUUAGAGAGAG GGGGGGGAUUAGGGGGGG GAGAGUGUAAGUGUGAGA

Q: Consider the following chart: What type of mutation is this? DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC…

A: By the translation process polypeptide chain is being synthesized from the mRNA sequence by the help…

Q: You would like to use a CRISPR-Cas system to knockout a gene that includes the following sequence:…

A: CRISPR (Clustered regularly interspaced short palindromic repeats)-Cas is a gene-editing tool. It…

Q: The hypothetical mRNA sequence below contains the coding region for a short peptide. What…

A: Mutation generally occurs when the base pair of the DNA gets altered by Mutagens or other chemicals…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: The central dogma of life can be stated as follows: Replication of DNA to form new copies of DNA…

Q: Consider the following 2 codons sequences. Codon sequence 1:  ACU AGA GAU GUC UGC Codon sequence…

A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’  If there are…

A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…

Q: The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide…

A: mRNA consist of mononucleotide sequence that specifies amino acids sequence in peptide chain. One…

Q: What are the possible codons that a tRNA molecule could interact with if it is carrying each of the…

A: A codon is a triplet nucleotide of DNA or RNA corresponding during protein synthesis to a particular…

Q: In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures…

A: Cruciform DNA is a form of non-B DNA that requires at least a 6 nucleotide sequence of inverted…

Q: 5' guanine cap 5' AUGCCGAUGCCUCCUAUCAGAUAAAAUAAA poly A tail AAAA 3' During DNA replication, a…

A: The mutation is the sudden and abrupt change in the structure and function of the chromosomes.

Q: Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand.…

A: This is the DNA which ultimately decides what amino acid sequences are going to be added to form a…

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Complete the DNA and RNA sequencing for the translation and creation of proteins. 1. DNA  3' CCC…

A: The genomic structure of an organism consists of DNA which contains sugar molecule, phosphate group,…

Q: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…

A: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…

Q: Which one of the following options would be a good way to identify the location of the poly A tail…

A: Pre mRNA undergoes several post-transcriptional modifications. One of these modifications is…

Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…

A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…

Q: Which of the following pairs of sequences might be found at the ends of an insertion sequence? a.…

A: Insertion sequence (IS) is defined as a short sequence of DNA acting as a transposon (jumping gene…

Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…

A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…

Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: ou have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100…

A: Natural selection is a theory that states that organisms evolved by changing their heritable traits…

Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…

A: Option 1 i.e. 5' AUA 3' is the correct answer.

Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…

A: The central dogma of life includes the following processes: Replication: In this process, the DNA…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…

A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…

Q: When examining the genetic code, it is apparent that ________.     there are 44 stop codons…

A: The process of polypeptide chain synthesis or protein synthesis is known as translation. By this…

Q: For the RNA sequence AUUGGCAUCCGAUAA, draw the secondary structure that maximizes its base pairing.

A: RNA molecules usually come as single strands but when left in the environment, they fold themselves…

Q: If the DNA duplex for the beta chain of haemoglobin represented by the sequence…

A: Given the template strand in transcription unit is 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' If the…

Q: These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Q: Below is a sequence of DNA.…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: what is the anticodon sequence that would build this protein?

A: The process of formation of mRNA sequence from a DNA transcript is known as translation. In mRNA,…

Q: From the given DNA base sequence indicated below:…

A: The process by which the information contained in the DNA is converted to RNA is referred to as…

Q: Select all of the factors in the list below that play a role in the translation initiation of…

A: Translation : It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: Which of the following anticodons of a tRNA molecule can base pair with three different codons on an…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…

A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…

Q: List the sequences of RNA that would be transcribed from the following DNA template sequences.…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. It contain genes that…

Q: Which of these single strand RNA sequences could form a hairpin secondary structure?     5'…

A: The RNA is usually a single stranded molecule of nucleic acid. In RNA four types of nitrogenous…

Q: Is each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original…

A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur due to…

Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…

Q: Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a.…

A: Nucleotides  The bases found in the molecules of DNA are known as nucleotides. They are the building…

Q: You have sequenced the genome of the bacterium Salmonella typhimurium and a protein that is 100…

A: The protein sequence is dependent on the DNA sequence. When DNA is transcribed, it forms mRNA and…

Q: The sequence shown below is the 5' to 3' strand of a dsDNA template. What are the sequences of the…

A: So, for choosing the primers for PCR, following requirements must be fulfilled :- 1. It should be…

Q: Draw the stem-loop structure and the homodimer structure this RNA sequence (GGCCCUUUUCAGGGCC) can…

A: Single-stranded RNA (ribonucleic acid) having regions of complementary ribonucleotides can form…

Q: Given Sequence:

A: The genetic information stored in a cell is transcribed into a messenger RNA by the process of…

Q: The mature m-RNA is capped by which of the following heterocyclic bases (or which of the following…

A: Transcription is a process through DNA is converted into mRNA.

Q: What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA)…

A: Multiple sequence alignment (MSA) is the process or outcome of aligning three or more biological…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.