Biology
Biology
12th Edition
ISBN: 9780134813448
Author: Audesirk, Teresa, Gerald, Byers, Bruce E.
Publisher: Pearson,
bartleby

Videos

Textbook Question
Book Icon
Chapter 14.4, Problem 1TC

For any single person, a given STR always has either one or two bands. Why? Further, single bands are always about twice as bright as each band of a pair. For example, in the D16 STR on the right, the single bands of the first and third DNA samples are twice as bright as the pairs of bands of the second, fourth, and fifth samples. Why?

Blurred answer
Students have asked these similar questions
DNA from 100 unrelated individuals from one population of Chinook salmon were amplified at a single microsatellite locus, and run on an agarose gel. The results from gel electrophoresis shows three different fragment lengths (i.e. alleles/band positions) corresponding to 3 alleles; Allele F (250bp), Allele R (180bp), and Allele Y (100bp). The numbers at the top of each lane is the number of fish observed with that particular genotype or banding pattern in the population. Note that a single band means a homozygote for that allele (band size). a) Calculate the allele frequency for Allele Y. (b) Calculate the genotype frequencies for the following genotypes: FF, FR, and RY. (c) What is the expected number of Chinook salmon with homozygous genotype for allele Y in the study population? (d)What is the name of the statistical test that you could conduct to test whether this population of Chinook salmon is in Hardy Weinberg Equilibrium
How would you estimate the size of the unknown DNA fragement just by looking at the gel?
Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…

Chapter 14 Solutions

Biology

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Serology 101: Testing for IgG and IgM antibodies; Author: Beckman Coulter Dx;https://www.youtube.com/watch?v=LtqKB-qpJrs;License: Standard youtube license