HW 4 - Gene Expression - Sp23

DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B IC| D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?

Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.

Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?

DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.

5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?

F. RNA TRANSCRIPTION AND GENE EXPRESSION 1. The template strand of a segment of double-helical DNA contains the sequence (5) СТТААСАССССТGAСТТСGCGCCGTCG (3') What is the base sequence of the mRNA that can be transcribed from this strand? b. What amino acid sequence could be coded by the mRNA in (a), starting from the 5' end? а.

You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome

GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…

1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…

5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3'  b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'

1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队 相阳阳一即即的 9 First letter…

Your DNA has been mutated! Carry out the following mutations, separately: a) In the original sequence, change the blue C (arrow 1) to a T. Transcribe and translate again. mRNA: 5'  3' amino acids (single-letter):    b) In the original sequence, change the red C (arrow 2) to a G. Transcribe and translate again. mRNA: 5'  3' amino acids (single-letter):    c) In the original sequence, change the purple G (arrow 3) to a T. Transcribe and translate again. mRNA: 5'  3' amino acids (single-letter):    d) In the original sequence, delete the green G (arrow 4). Transcribe and translate again. mRNA: 5'  3' amino acids (single-letter):

Q8. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: ТАСТCGTCGACGATGATC (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working. Second base C UUU Phenyl- UUC alanine UCUT F UCC UGU UAU1 UAC Tyrosine Y UGCFCysteine C Stop codon Tryptophan U -Serine UCA UUA FLeucine L UCGJ UAA UAG Stop codon UGA Stop codon UGG W S UUG CUUT CUC CUA CUG CCUT CAU1 CAC CGUT CGC CGA CAGGlutamine CGG Histidine H FLeucine L CC СА -Proline -Arginine R CAA CCG] AAU Asparagine AAC I AUU AUC FIsoleucine A AUA ACUT ACC ACA AGU] AGC N. AGA Arginine -Serine S Threonine AAA Lysine AUG MMethionine ACG] start codon AAG K AGG GUUT GCUT GCC GCA GCG GAULAspartic GACacid GGU GUC G GUA D -Valine V Alanine GGC Glycine G GGA GAA Glutamic A GAGacid GUG E GGG. (United Kingdom) Third base DCAG UCAG DCAG UCAG First base

(a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many initiation cycles are needed for a protein with 150 amino acids? (c) How many elongation cycles are needed for a protein with 150 amino acids? (d) How many termination cycles are needed for a protein with 150 amino acids?

Remember: for every DNA and RNA sequence you determine in this assignment, do not forget to indicate the 5' and 3' ends The following is the DNA template strand for a specific gene. The sequence does not include a promoter region or the terminator region. 3' | A|C|A| |GT|G|T|ATAA A A CC G|CGIIT TCTCC|AG|CT|T|G|C|G|G|G| G|G|A|T|T|G|C|G|C|A |A G CCAAA|G|ACAA|TAGG|ATACGTA |ATCTTT| 5' 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the MRNA primary transcript sequence 5' GGG AUG UCA CÁC AUA UUU 1 2 3 4 5 6

Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA MRNA G C C G T A 6. What is the name of the enzyme which catalyzes this reaction? 7. What three things must then happen to the pre-MRNA you just synthesized before it is allowed to exit the nucleus? 8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time to transcribe the mRNA. You may use the abbreviations for the amino acids found in Figure 15.8 of your textbook DNA C A G C A C C T. G A G C C A MRNA Peptide chain

Q6. How many exons does tra-RA contain? Q7. How many introns does tra-RA contain?

30  A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide. Please explain step-by-step how exactly you go from the DNA sequence given to the final answer.

Second Letter EQ#10 G. UU UCU UAU Tyr UGU Cys Phe UUC UCC Ser UCA UGC UGA Stop UGG Trp UAC U UAA UUA Leu UUG Stop UCG UAG CGU CCU CCC CAU His CAC CAA CUU CUC Leu CỦA Pro ССА CCG CGC Arg CGA Gla CAG CGGJ Third CUG) First Letter Letter AAU Asn AAC AGU Ser AGC ACU ACC ACA ACG AUU AUC le AGA Arg AGG A AUA AUG Met AAA Lys AAG GGU GGC GUU GCU GAU GCC Ala GCA GAC Asp GAA Glu GAG GUC Val GUA Gly GGA G 15. Given the following (the start of a very long MRNA sequence), GUG GCG) GGG 5' CCGUAAGAUGGCGAACACAUUGUCAUCCAAUGC.... .... 3' what amino acid sequence would be produced in a cell? 16. If the red "U" in the RNA was changed to an A (due to a DNA mutation, for example), what would be the likely effect on the protein, and how might that alter the protein's function? UCAG UCAG UCAG UCAG 复5 C.

5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene

52Protein synthesis takes place on ( ). 53The eukaryotic pathway of polypeptide chain elongation is the same as the bacterial pathway except that eEF1A and eEF2 replace eF1A and EF2. Yesorno 54Which experiment show that σ70-RNA polymerase combines with promoter DNA to form a closed and an open complex?A.Footprintingb.Southern blottingc.ComplementationD.DNase protection

The coding DNA strand of a gene has the following DNA sequence:  5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene.  2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!

Order+the+following+of+protein+sentesis+sequence+from+earliest:                         (a)tRNA molecule bring specific amino acids to he mRNA molecule.                     b)mRNA nucleotides join with exposed DNA bases and form a molecule of mRNA.(c)The two stands of a DNA molecule separate.                                                   (d)Peptide bonds form between the amino acids.                                                               (e)the mRNA molecule leave the nucleus.                                                                         (f) a ribosome attached to the mRNA molecule.

30  A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… a)Locate the sequence encoding the five amino acids of the polypeptide, and identify the template and coding strand.

Q10. Does frame +2 have an ORF in the coding region of this exon? What about frame +1 and frame +3? Q11. Given that 3 of the 64 possible codons are stop codons, what is the chance of having a stop codon at any given position, assuming that the sequence is random?

10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an

Val (V) Ala (A) Arg (R) Ser (S) Lys (K) Start Stop Using the codon wheel below, identify which of the following mutations of the DNA sequence TTT TAC ACT would potentially have the least effect on the protein containing the sequence? Asp (D) G A JOOGA C Asn (N) اندان A داد Glu (E) 9/2/3. 20402 CAGUCAGUCAGUC GU ט|כ Thr C U G G A Gly A A Phe (F) C/U/G ●Met (M) Leu (L) GU AC C CUGA GACUGA ACUGACUG A Arg (R) G כט Ser (S) C U с Gin (Q) A G U C A G બનીનો His (H) Tyr (Y) U G C Cys (C) Pro (P) Trp (W) Leu (L) A) TTA TAC ACT B) TTT TTC TCT C) TTT TAC TGA D) TAA AAC AGA E) They would all have the same effect.

3. A student in my lab was trying to express the cytosolic (not membrane bound) enzyme PseG and decided to express the enzyme as a Hisí fusion (PseG-His) to ease purification. In his initial experiments, he (1) expressed the protein in bacterial cells (E. coli), (2) lysed the bacteria using a gentle lysis buffer (one that would solubilize folded proteins), and (3) assessed the protein's presence in whole-cells (WC) pre-lysis, and pellet (P) versus soluble (S) cell fractions post-lysis, by SDS-PAGE analysis. In his first expression experiment, he collected the data shown in Figure 1: kD 58 46 kD MW WC PP 175 80 58 46 30 25 │I T||| || | 10- Coomassie-stained protein gel a. From these initial data, what can you conclude about the following features of PseG-His6 in E. coli? Expressed? Soluble? Folded? 10->> In a follow-up experiment, my student (1) expressed the protein in bacterial cells (E. coli), (2) lysed the bacteria using a harsh lysis buffer that included 6 M urea (a detergent), and…

Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein.    Wild Type DNA Sequence:  3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence:    3' - AGTCTCGCCTGT - 5'

Remember when looking up a codon make sure it is in its mRNA form.   Below is a sample of a segment of DNA…(copy from left to right)   3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’   5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’   What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids).    2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this?  If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age.  What problem does this create?   3.What are three differences between a point mutation and deletion mutation