1107L-GI
.docx
keyboard_arrow_up
School
University Of Georgia *
*We aren’t endorsed by this school
Course
1107L
Subject
Biology
Date
May 8, 2024
Type
docx
Pages
2
Uploaded by HighnessGoldfinch2521 on coursehero.com
BIOL 1107L Gel Interpretation
1)
You have to identify two unknown plasmids using Restriction Digest analysis. You miss lab when your group performs gel electrophoresis of your digests of plasmids 1 and 2 using different combinations of the enzymes Eco RI, Bam HI, and Hind III. They send you a picture of the gel showing their results (above), but they forget to tell you which lane corresponds to which digest. All you know is that lanes 1 and 10 are the molecular weight markers (DNA Ladder) with bands at 8000, 5000, 3000,1000, 500, and 100 base pairs (bp). Use the information
from the gel and restriction digest maps to answer the questions below. (1 pt each)
a. Which lane would represent the products of a digest of Plasmid 1 with EcoRI? Lane 3 or Lane 6 b. Which lane would represent the products of a digest of Plasmid 2 with Bam HI and EcoRI? Lane 4 and 9
c. Identify which plasmid was cut with Bam HI and resulted in Lane 5. Plasmid 1 MWM
8,000 bp
5,000 bp
3,000 bp
1,000 bp
500 bp
100 bp
MWM
8,000 bp
5,000 bp
3,000 bp
1,000 bp
500 bp
100 bp
BIOL 1107L Gel Interpretation
2) Would you categorize gel electrophoresis as a qualitative or quantitative analysis? Explain your reasoning. (2 pts) Gel electrophoresis is both quantitative and qualitative. It is quantitative because you can identify the number of base pairs. It is qualitative because it can be measured with images based on the weight of the fragment. 3) Before analyzing the gel results you need to evaluate the success of your PCR, RE, and gel electrophoresis.
(2 pts)
Briefly explain if your gel electrophoresis ran properly or not and how you came to your conclusion. Our gel electrophoresis ran properly because the bands moved from the negative end to the positive end.
Explain how will you know if your PCR was successful or not. We will know that our PCR was successful because there should only be one fragment in the lane with the uncut PCR.
Explain how you can determine if your RE digest was successful or not. If our RE digest was successful, our gel electrophoresis will show more than one band on the lane with EcoRI and Hind III. 4)
Using the information in the table of fragments calculated from the Restriction Enzymes Product, analyze the results of the gel electrophoresis. Based on your sample, determine which primer set corresponds to your letter code. Label of Unknown Primer Set: U G A
Record all the bands observed for your sample wells of the gel results: Based on the results of bands observed, what do you think is the unknown primer set? (1 pt)
Identity of Unknown Primer Set: 1 2 3
Explain the rationale for your selection. (2 pts)
Our gel electrophoresis produced fragments with numbers of base pairs most like those observed for Primer Set #3. For example, for the lane (lane 5) with Hind III digest one fragment was approximately 500 bp. Another fragment was about 1500 bp and the last fragment was about 2500 bp. These numbers are very similar to the number of base pairs associated with the Hind digest of primer set #3.
Sample Name
Lane #
Band(s) Observed and Length in Base Pairs
Control (uncut PCR product)
3
1 band and 4500bp
EcoRI Digest
4
2 bands and 5000bp and 800bp
HindIII Digest
5
3 bands and 500 bp and 1500bp and 2500bp
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
- Access to all documents
- Unlimited textbook solutions
- 24/7 expert homework help
Related Questions
Kpnl
4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and
Pstl (P) cut sites relative to each other.
This plasmid was digested with three different restriction enzymes
2000 bp
3500 bp
Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the
samples run on an agarose gel as shown below.
Where does Bgll (B) cut this plasmid ? Does the plasmid have one
recognition site or two for Bg|l?
Describe the Bgll cut site in this plasmid relative to the Kpnl cut
Plasmid Z -7 kb
Pstl
site. How many bases to the left or right of the Kpnl cut site would
you observe the Bgll cut site. Explain briefly.
1500 bp
Pstl
Ladder
Kpni
Psti
K/P
Bgl
K/B
KPB
7000 bp
7000 bp
5600 bp
5500 bp
4900 bp
3500 bp
2000 bp
1500 bp
1500 bp
1500 bp
1400 bp
600 bp
%3D
arrow_forward
Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately.
5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’
arrow_forward
Restriction mapping sample question
You have a 5.3 kb PstI fragment cloned into the PstI
site of the vector pUC19, which is 2.7 kb in size. This
vector has unique sites for the following enzymes in a
multiple cloning site:
PstI, HincII, Xbal, BamHI, SmaI, EcoRI
A restriction map of the 5.3 kb insert is prepared. The
recombinant plasmid is digested with the enzymes
listed above in single digests, and then several
combinations of enzymes are tested in double
digests. The following bands are observed when the
digests are run on a gel:
Enzyme(s) used
PstI
ECORI
HincII
Band sizes observed (kb)
5.3, 2.7
5.4, 2.6
4.5, 3.5
6.7, 1.3
| 4.0 (high intensity band)
3.9, 3.7, 0.4
4.0, 3.5, 0.5
3.5, 2.6, 1.9
3.7, 3.6, 0.4, 0.3
3.7, 2.2, 1.7, 0.4
3.7, 3.0, 0.9, 0.4
3.9, 3.5, 0.4, 0.2
Smal
Xbal
ВатHI
HinclI + Xbal
HincII + ECORI
XbaI + BamHI
ECORI + BamHI
Smal + BamHI
HincII + BamHI
Use the data above to construct a map of the cloned
insert. Note that fragments smaller than 100 bp will
not usually be…
arrow_forward
PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction)
is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the
data given below.
Hindlll
Hindll
BamHI +BamHI
Figure 1: 1% agarose gel electrophoresis of pCHEM4321
40
24
16
12
12
8
4
4
+
|
arrow_forward
biotechnology lab class :1. The bacterial streaking on antibiotic containing agar plates has been completed and the plates will be available for you to inspect in the lab class.2. You will complete a restriction enzyme digest on the four available plasmid stocks and then examine the products by agarose gel electrophoresis.
Photographs of the gel are attached to identify the plasmid present in each analysed sample.Now consider the following questions :- For each of the four plasmids used in the practical, identify the size (in kb) of the linear DNA fragment(s) that you would expect to obtain if the EcoRI digest is complete.- Using the provided negative image of the gel, which shows the bands present in the ND and D samples for each plasmid, identify the plasmid that was present in each of the four plasmid stock.- Explain how you were able to identify plasmid in each sample using the gel, considering how linear DNA fragments of different length are separated by agarose gel…
arrow_forward
EcoRI
1.1kbp
1.5 kbp
Hindll
Hindll
0.15 kbp
amp
0.25 kbp
EcoRI
If you were to digest this plasmid with HindllI, how many fragments would be visible using gel electrophoresis?
O 1
O 4
arrow_forward
Attached is an image of EcoRI-digested plasmid samples (pBSK and pEMBL1.9); explain why the bands are found at the top, the purity of the results, and how we couple improve our results.
arrow_forward
How does SYBR green work in DNA imaging and why does the uncut plasmid run faster than the cut plasmid? Please Explain.
Thank you
arrow_forward
In DNA purification, explain how the chromosomal DNA is separated from the plasmid DNA? Be sure to mention the specific buffer components that facilitate this process.
arrow_forward
You have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.)
How many times did the enzyme cut the plasmid?
What is the size of the plasmid?
Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.
arrow_forward
DNA Extraction by Alkaline Lysis
Procedure:
1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to
pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip.
The spins can be performed at 4C or at room temperature. Longer spins make it difficult
to resuspend cells.
2. Resuspend pellet in 100µl GTE solution and let sit 5 min at room temperature. Be sure
cells are completely resuspended.
3. Add 200µl NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5
min.
4. Add 150µl potassium acetate solution and vortex at maximum speed for 2s to mix.
Place on ice for 5-15 min. Be sure mixing is complete.
5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA.
6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4
ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids.
7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…
arrow_forward
Practice question #3 chap. 2 p. 145
3. What do you think happened? How do you explain this result?
Your supervisor gives you an E.coli stain (strain PIP) with an F plasmid on which is coded resistance for ampicillin.
Your E.coli strain (strain ZAZ) is F- for the plasmid, and you would really like your strain to have ampicillin
resistance. To favour conjugation, you grow both strains together for 2h (in broth) and plate agar containing
ampicillin to grow single colonies overnight.
grow
overnight
Inoculate agar plate
containing ampicilline
(amp plates)
ZAZ colonies are blue,
PIP colonies are yellow.
Grow ZAZ and PIP
together for 2h
Figure 1. Schematic representation of the experimental plan.
In the morning, you find multiple colonies growing on your ampicillin resistant agar plates. Because you had mixed
both strains in the same culture, you needed to be able to distinguish between which colony is a ZAZ or a PIP
colony growing on your plate. Fortunately, your ZAZ strain grows blue on the…
arrow_forward
DNA and Protein Synthesis Retake Test
Using the chart below, what type of mutation would take place if the highlighted and underlined "A" was deleted?:
What amino acid sequence would be coded for with this mutation?
What would be the affect of this mutation on the organism? i
DNA
AAT
СТА
GTA
MRNA
UUA
GAU
CAU
Amino acid
Leu
Asp
His
:: point mutation
:: frame shift mutation
:: no affect on organism
:: affect on organism
: Leu - Asp - His
:: Leu - Asp - Asp
: Stop - lle - ?
: Tyr - Met -?
18
19
20
21
22
23 24
25
96
arrow_forward
Preforming a "blue-white screen"
3) Would bacteria that have taken up a plasmid into which a DNA fragment has been inserted, form a blue colony or a white colony when grown on this medium? Briefly explain why these bacteria would form a colony of the color you chose.
arrow_forward
A
amp
PBR322
4301
fot
B
Clear Zones
Figure 2
The postgraduate student, Demika, inserted her gene of interest into the plasmid, pBR322,
before transformation into the competent host cell using heat shock method. After that she
cultured the cells on the Ampicillin agar plate before replica plating the colonies onto another
Ampicillin (A) and Tetracycline (B) agar plates shown in Figure 2.
(1)
Referring to the vector pBR322 in Figure 2, which recognition site was cleaved to insert
the gene of interest?
Based on the observation above, can you identify which colonies are carrying positive
mcombinants of BR322? Explain your selection.
arrow_forward
Fluorescence confocal microscopy (FCM) - STK38 monoclonal antibody (M01), clone 2G8-
1F3.
a.
b.
200 μm
What is the basic principle of image formation using this microscopy technique?
What can be observed and concluded from the image of the specimen?
arrow_forward
DNA Isolation
A. What is “cell lysis” and why would you want to lyse cells when doing a DNA extraction?
B. What do the “proteases” like meat tenderizer do to the DNA?
C. What two ingredients help precipitate the DNA out of solution?
arrow_forward
Plasmid Mapping (what is it? why is it important?).
arrow_forward
DNA Extraction by Alkaline Lysis
Procedure:
1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to
pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip.
The spins can be performed at FC or at room temperature. Longer spins make it difficult
to resuspend cells.
2 Resuspend pellet in 100pul GTE solution and let sit 5 min at room temperature. Be sure
cells are completely resuspended.
3. Add 200ul NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5
min.
4.
Add 150ul potassium acetate solution and vortex at maximum speed for 2s to mix.
Place on ice for 5-15 min. Be sure mixing is complete.
5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA
6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4
ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids.
7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…
arrow_forward
Calculate these for 1 ug of plasmid DNA in a final total volume of 20 ul. All
enzymes being used here are at a concentration of 10 U/µL. For double digests, give the
appropriate volume for each enzyme and decide which buffer to use. (HINT: look up double
digest conditions on the NEB website.) You should always calculate all volumes in advance to
ensure the correct working concentrations and so that you can prepare the digests as efficiently
as possible. It is a good idea to check off each component as it is added to the microfuge tube.
Complete the table below, including the volume of DNA sample(s) you will need for 1 pg of the
DNA (from two different methods in Experiment #3) based on the concentration(s) you
determined from the OD260 value, which you will restriction digest with each of the restriction
enzymes singly and in double digests in Part A.
For example, the volume of DNA sample that contains 1 µg DNA for DNA sample from Part A,
Experiment 3: OD260 = 0.024, dilution 500x…
arrow_forward
Help Please
Supercoiled DNA migrates through an
agorose gel faster than similarly sized linear
DNA? True or False?
Using the plasmid map, indicate where (bp region on plasmid) these enzymes cut on
the plasmid.
EcoR1
1. 1
Hindlll
2. 637
Bpu101
3. 14
BamHI
4. 256
To sequence a DNA plasmid, you need 1 µg of DNA.
If your DNA concentration was 0.45 µg/µL. How many µl of your DNA 0.45 µg/µL
is required to get 1 µg final? Answer in µl using 2 decimal places.
Your Answer:
Answer
units
>
arrow_forward
Part E - Exploring parallel sheet structure and hydrogen bonding patterns
A different segment of a 3 sheet found in GFP has two parallel strands. The hydrogen bonding between parallel sheets, also visible in the pdb by selecting the parallel sheet
view, is shown. First, locate the N- and C-termini in this image. Next, look for a pattern in the hydrogen bonding in parallel 3 sheets
Select the parallel sheet view in the pdb file. Complete the sentences describing the relationship between the two strands making up the sheet.
Match the words in the left column to the appropriate blanks in the sentences on the right.
arrow_forward
Preparing plasmid DNA (double stranded, circular) for Sanger sequencing involves annealing a complementary, single-stranded oligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplished by heating the plasmid DNA and primer to 90°C and then slowly bringing the temperature down to 25°C. Why does this protocol work? What enzyme is used and what other components are required in the sequencing reaction? How does the Sanger method determine the sequence?
arrow_forward
2. Restriction Enzyme Mapping - use any resources to assist you including
the hints below.
A circular plasmid molecule (12,000 total base pairs in size) was cut with a
series of restriction enzymes and the digestions were size fractionated by
agarose gel electrophoresis. Some digestions involved just one enzyme (single
digest), some combinations of two enzymes (double digests), and one utilized all
three enzymes (triple digest).
Agarose gel electrophoresis of the digestions produced bands of the following
sizes.
Enzyme
EcoRI
Hindi!!
Pstl
EcoRI and Hindill
EcoRI and Psti
Hindill and Pstl
EcoRI, Hindill, and Pst I
Bands of the Agarose Gel (size in base pairs)
2300 and 9700
4000 and 8000
12,000
800, 1500, 2500, and 7200
2300, 3200, and 6500
4000
800, 1500, 2500, 3200, and 4000
I
Draw a plasmid map showing the location of the restriction enzyme sites
relative to each other for each map. Include all 7 maps in your answer.
arrow_forward
You are provided with cultures of E. coli cells that contain the plasmid pUC118. Each student should carry out the plasmid isolation procedure. Note the appearance of the suspension after steps (v), (vi) and (vii).
The steps are
(v). Resuspend the bacterial pellet in 300 μl solution A [25 mM Tris-HCl (pH 8.0) 10 mM EDTA. Ensure that the suspension is homogeneous.
(vi). Add 300 μl solution B [1% (w/v) SDS 0.2 M NaOH] and mix thoroughly.
(vii). Add 300 μl solution C [3M potassium acetate, (pH 4. 3)], mix thoroughly, and incubate on ice for 5 minutes.
arrow_forward
ull rain LTE
11:53
© 1 0 A 10%
Done #1 Mol Bio Restriction Analysi...
Complete the following problems.
Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular
biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences
by analyzing the fragments generated upon restriction digest, as in the example shown in Figure
1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected
the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI,
and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean
from this gel, answer the questions that follow.
EcoRI
BamHI
Xhol
DNA
size
ladder
600 bp
500 bp
400 bp
300 bp
200 bp
100 bp
VC 100bp Plus DNA ladder
from Vivantis Technologies
*The same total amount of DNA was loaded in each lane.
1. What is the total size of the PMBBS plasmid in bp?
Answer:
bp
2. How many cut sites on the…
arrow_forward
You will be setting up your diagnostic digest on three plasmids, the ones you began with, pGFPuv and
PHSG298 and your presumptive pHSG298-GFP. Complete the table below:
Solution
Stock Working Volume for one reaction
Volume for Master Mix (3.5X)
Cutsmart buffer
10X 1X
Restriction enzyme(s)
1 µl
uL
Water
UL
UL
2 µl
25 pL
DNA
Total volume
arrow_forward
In bacterial transformation ...
1, Why do you have to incubate the competent bacterial cells on ice after the addition of plasmid DNA?
2. Why do you have to add SOC (Super Optimal Broth with Catabolite repression) medium to bacterial cells?
3. Why do you have to incubate the bacterial cells in SOC medium at 37oC for 45 minutes?
arrow_forward
4. Look at the gel image and answer the questions below and be specific.
a) Based on your calculations of the DNA concentrations, how much DNA was
loaded into each well? Do you see DNA for each of your samples? If not, why do
you think that is so?
b) Is the DNA in a single sharp band, multiple bands or a smear? What would each
of these scenarios be due to, and why would you see them for your samples?
c) Do you see multiple bands in your plasmid DNA sample? What are they?
arrow_forward
Gel Electrophoresis
A. Why does DNA travel toward the positive electrode in the gel chamber?
B. What is a ladder sequence and why is it useful to include in a gel?
arrow_forward
SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Related Questions
- Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one recognition site or two for Bg|l? Describe the Bgll cut site in this plasmid relative to the Kpnl cut Plasmid Z -7 kb Pstl site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpni Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp %3Darrow_forwardRestriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’arrow_forwardRestriction mapping sample question You have a 5.3 kb PstI fragment cloned into the PstI site of the vector pUC19, which is 2.7 kb in size. This vector has unique sites for the following enzymes in a multiple cloning site: PstI, HincII, Xbal, BamHI, SmaI, EcoRI A restriction map of the 5.3 kb insert is prepared. The recombinant plasmid is digested with the enzymes listed above in single digests, and then several combinations of enzymes are tested in double digests. The following bands are observed when the digests are run on a gel: Enzyme(s) used PstI ECORI HincII Band sizes observed (kb) 5.3, 2.7 5.4, 2.6 4.5, 3.5 6.7, 1.3 | 4.0 (high intensity band) 3.9, 3.7, 0.4 4.0, 3.5, 0.5 3.5, 2.6, 1.9 3.7, 3.6, 0.4, 0.3 3.7, 2.2, 1.7, 0.4 3.7, 3.0, 0.9, 0.4 3.9, 3.5, 0.4, 0.2 Smal Xbal ВатHI HinclI + Xbal HincII + ECORI XbaI + BamHI ECORI + BamHI Smal + BamHI HincII + BamHI Use the data above to construct a map of the cloned insert. Note that fragments smaller than 100 bp will not usually be…arrow_forward
- PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |arrow_forwardbiotechnology lab class :1. The bacterial streaking on antibiotic containing agar plates has been completed and the plates will be available for you to inspect in the lab class.2. You will complete a restriction enzyme digest on the four available plasmid stocks and then examine the products by agarose gel electrophoresis. Photographs of the gel are attached to identify the plasmid present in each analysed sample.Now consider the following questions :- For each of the four plasmids used in the practical, identify the size (in kb) of the linear DNA fragment(s) that you would expect to obtain if the EcoRI digest is complete.- Using the provided negative image of the gel, which shows the bands present in the ND and D samples for each plasmid, identify the plasmid that was present in each of the four plasmid stock.- Explain how you were able to identify plasmid in each sample using the gel, considering how linear DNA fragments of different length are separated by agarose gel…arrow_forwardEcoRI 1.1kbp 1.5 kbp Hindll Hindll 0.15 kbp amp 0.25 kbp EcoRI If you were to digest this plasmid with HindllI, how many fragments would be visible using gel electrophoresis? O 1 O 4arrow_forward
- Attached is an image of EcoRI-digested plasmid samples (pBSK and pEMBL1.9); explain why the bands are found at the top, the purity of the results, and how we couple improve our results.arrow_forwardHow does SYBR green work in DNA imaging and why does the uncut plasmid run faster than the cut plasmid? Please Explain. Thank youarrow_forwardIn DNA purification, explain how the chromosomal DNA is separated from the plasmid DNA? Be sure to mention the specific buffer components that facilitate this process.arrow_forward
- You have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.arrow_forwardDNA Extraction by Alkaline Lysis Procedure: 1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip. The spins can be performed at 4C or at room temperature. Longer spins make it difficult to resuspend cells. 2. Resuspend pellet in 100µl GTE solution and let sit 5 min at room temperature. Be sure cells are completely resuspended. 3. Add 200µl NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5 min. 4. Add 150µl potassium acetate solution and vortex at maximum speed for 2s to mix. Place on ice for 5-15 min. Be sure mixing is complete. 5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA. 6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4 ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids. 7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…arrow_forwardPractice question #3 chap. 2 p. 145 3. What do you think happened? How do you explain this result? Your supervisor gives you an E.coli stain (strain PIP) with an F plasmid on which is coded resistance for ampicillin. Your E.coli strain (strain ZAZ) is F- for the plasmid, and you would really like your strain to have ampicillin resistance. To favour conjugation, you grow both strains together for 2h (in broth) and plate agar containing ampicillin to grow single colonies overnight. grow overnight Inoculate agar plate containing ampicilline (amp plates) ZAZ colonies are blue, PIP colonies are yellow. Grow ZAZ and PIP together for 2h Figure 1. Schematic representation of the experimental plan. In the morning, you find multiple colonies growing on your ampicillin resistant agar plates. Because you had mixed both strains in the same culture, you needed to be able to distinguish between which colony is a ZAZ or a PIP colony growing on your plate. Fortunately, your ZAZ strain grows blue on the…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education