+1 1 4 6. 7 8 9. Transcriptional stop sequence +1 ТАTA box ATG ТАА AUG UAA Here is a diagram of a human gene in the genome. The bar above it is indicating different regions of the gene sequence. 7. Which region or regions direct splicing? LO
Q: You want to produce a biological agent to kill bacteria that cause disease. Which organism you will…
A: Antibiotics are drugs that help the host's defense mechanism combat infection by preventing…
Q: Q12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: The stem cells have 3 properties: 1. They are Self-renewal2. They are Unspecialized3. They have…
Q: 28. Tomato seeds develop from: bees. flowers. pollen. a fertilized ovule.
A: Every tomato seed contains a tiny tomato plant that is alive but dormant. This means that it is not…
Q: The mechanism responsible for the high heritability of height and also explain why it still be…
A: Polygenic characteristics are a group of features that result from the interaction of many genes.…
Q: Translate the following mRNA. Use the space for your answer.…
A: Translation The process of converting nucleic acid information into amino acids. It is also relates…
Q: Short Answer. 1. Predict what would happen to a peppered moth population . The light lichens on the…
A: Prey and predator species In an ecosystem variety of organisms live together with these all share…
Q: A population has 80 EE individuals, 18 Ee, and 2 ee. The frequency of th E allele is
A: Hardy-Weinberg equilibrium p2 + 2pq + q2 = 1 or p+ q=1 allele: p = frequency of allele Eq =…
Q: Which of the following interactions will NOT provoke an immune response? A. Endogenous antigen +…
A: Ans - d) Endogenous antigen + MHC Class I + BCR, will not provoke an immune response. The two types…
Q: What is the course of a typical acute infection? O a. Virus entry, innate defenses, memory response,…
A: During the acute infection , first virus enters into the body and then undergo into the period of…
Q: their 8-year old boy with progressive muscle weakness, and difficulty in motor skills resulting to…
A: DMD is an inherited disorder of progressive muscular weakness, typically in boys. It may follow a…
Q: 1. How far should you record and observe any fauna encountered outside the quadrat? Why do you think…
A: Quadrats: Quadrats are simple devices that are highly beneficial in studying the abundance of…
Q: Question: How are amino acid precursors obtained from fatty acids? Show the pathway clearly
A: Introduction The breakdown or storage of fats for energy, as well as the production of structural…
Q: What type of mutation is depicted by the following sequences (shown as mRNA)? Wild type ....5′…
A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors, occurs…
Q: 1) In the intracellular fluid, The TOTAL concentration of cations exceeds that of anions. True or…
A: Water makes up between 55 percent to 65 percent of body weight, depending on age, gender, and body…
Q: 1. TLR recognition induces APCS to: I. Stop pinocytosis/phagocytosis II. Decrease expression of MHC…
A: The immune system is a complicated physiological system comprised of several organs, tissues, and…
Q: A transposable element or sequence of DNA that can move within the genome Group of answer choices…
A: Transposable elements or sequences of DNA that can move within the genome are also called jumping…
Q: 24 "Hydroelectric Dam" from "Hydroelectric Dam" The picture below is a simple diagram of a…
A: Gravitational energy Motion
Q: -What are the cost, scheduling, and other managerial requirements of a pacemaker?
A: A pacemaker is an electrical device that is designed to be implanted in the human body (usually the…
Q: Discuss all the importance of epithelium found in the digestive tract.
A: The stomach is a major organ of the digestive system. It resembles a sack and is responsible for…
Q: The Function of skeletal system all except support body O protection of internal organ movement O…
A: Introduction :- The bones make up your skeletal system, which provides support for the rest of your…
Q: QUESTION 12 The images shown depict the initiation and elongation steps in protein translation. P.…
A:
Q: What are the economically important members of the Musaceae family? Give its characteristics and…
A: Musaceae is a group of Flowering plants made out of three genera with around 91 known species,…
Q: 12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Introduction:- Flatworms are acoelomate animals that include parenchyma cells, which are used to…
Q: Describe what three strategies are used to identify microorganisms?
A: Microorganisms: Microorganisms are tiny organisms that are not visible through an unaided eye.…
Q: Elucidate the fundamental challenges the aquatic vertebrates and terrestrial vertebrates face in…
A: Terrestrial vertebrates... like...The human excretory system functions to remove waste from the body…
Q: A large percentage pf living species on earth live in tropical rainforests of the world. Why are so…
A: Biome is a region in which different group of organisms like plants or animals residing in a…
Q: How do we the to differentislands ? সभ ्कर सम्प कणागण
A: Biological diversity refers to all of the population ,species and communities in a defined area ,…
Q: Define mutualism. Give two example of a mutualistic interaction.
A:
Q: a. On the graph, use horizontal lines to indicate the level of potential energy that each of the…
A:
Q: When molecular biologists carry out a PCR, they have a range of different DNA polymerase enzymes on…
A: Polymerases α, δ, and ε are most active in dividing cells, suggesting that they function in…
Q: Which of the following species lived at the same time as modern Homo sapiens? O Homo habilis O Homo…
A: Homo floresiensis
Q: PLEASE ANSWER BRIEFLY. Thank you. 1. When the fibrinolytic factors is not regulated by the…
A: Fibrinolysis is physiological process, that prevents the blood clots from abrupt growth.…
Q: To determine: Whether landscape biology and restoration ecology are examples of in situ or ex situ…
A: The biological variety and variability of life on Earth is usually defined to stated as…
Q: True or false? Cellulose microfibrils are bonded together with other polysaccharides hence providing…
A: Cellulose microfibrils A microfibril composed of cellulose arranged in orthogonal layers(Cellulose…
Q: 2. Does the FITT formula help you build physical fitness? Why or why not?
A: Introduction Any physiological action that improves or maintains physical fitness and general health…
Q: Adding compost to farmed soil is better than adding synthetic fertilizer because: synthetic…
A: Introduction Compost is a combination of substances that is used to fertilise and enhance soil. It's…
Q: Biology In your own words describe how antisense RNA is used to regulate translation. Include…
A: Antisense Rna is a single stranded rna which is complimentary to mrna.
Q: Which of the following occurs within the submucosa in most regions of the Gl tract: Select one: a.…
A: Introduction The intestinal mucosa is the inner lining of the digestive tract, and it is in intimate…
Q: Topic:Excretion in animals Explain the roles of the lungs, kidneys and skin in the excretion of…
A: Introduction The process of excretion is the removal of wastes and excess water from the body. It is…
Q: What are the DIFFERENCES of Plants and Animals when it comes to BODY FLUID REGULATION.
A: Body fluid regulation or osmoregulation is the process, that controls the osmotic pressure of the…
Q: I need Plant Physiology Help Immediately Please If 2 molecules of phosphoglycolate are produced what…
A:
Q: In receptor mediated endocytosis, the receptors (such as the low-density lipoprotein, LDL, receptor)…
A: Receptors are the protein structure embedded in the cell membrane to transmit signals.
Q: ex. Locate any woodland or forest area close to your home. Create a 10 x 10 m quadrat once you've…
A: The goal of the study is to apply approaches to achieve the goal. During the process, information…
Q: Q12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Parenchyma is the tissue made up of cells and intercellular spaces that fills the interior of the…
Q: Which of the following changes would cause directional selection? a A habitat made of trees with…
A: Directional selection This selection takes place when organisms having characteristics represented…
Q: Myosin motor proteins are NOT involved in which of the following? Regulating the mitotic organizing…
A: Myosins are motor protein as well as signalling molecules. A complete round of ATP hydrolysis…
Q: Label the following parts of a Zea mays (corn): Epidermis Ground tissue Хylem Phloem Bundle sheath…
A: Introduction In a vascular plant, a vascular bundle is a strand of conductive tissue that conducts…
Q: Compare the reproductive organs of reptiles and birds. How are their reproductive patterns…
A: Although anatomy and physiology varies greatly among the diverse class Reptilia, the basic structure…
Q: 2"
A: Star fish are echinoderms that undergoes sexual reproduction and embryo development take place…
Q: A corpse was discovered in an apartment last November. It was that of a 50-year-old man who died of…
A: ANSWER;- post mortem interval is 7 hours
Step by step
Solved in 2 steps
- +1 1 2 4 6. 7 8. 9. Transcriptional stop sequence ТАTА box ATG ТА AUG UAA Here is a diagram of a human gene in the genome. The bar above it is indicating different regions of the gene sequence. 7. Which region or regions contain the sequences that direct splicing? - 8. In which region or regions could a single base pair insertion cause a frameshift mutation (but not because of changed splicing)? - 9. In which region or regions might you find sequences that control the amount of transcription of this gene? + 10. In which region or regions could a single base pair deletion cause the mRNA to be one base pair shorter? - 11. Which region or regions usually contain a sequence that controls the secretion of the protein e product? e5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this geneBM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- 37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?38.start with four exons and show mutually exclusive splicing producing 1-2-4 and 1-3-4 spliced exons. Second, start with two exons and show alternate 5’ splicing producing 1-2 and 1a-2 spliced exons. In one cell type, the 1a-2 isoform is more prevalent. Explain how SR protein binding to an ESE would regulate this preferred isoform. Be sure to include U1 in your response and define ESE.30. Below is a pre-mRNA sequence that contains 2 exons and an intronic region. Based on your knowledge of the spicing reaction, predict the ligated exon sequence. [ | (hint: there is a consensus sequence for this "cut n paste' rxn.] 5'-ACGACAGGAUGAAGGUAAAUCGGGUAGGGGCGGCUGACUCUCUUUUUCCCUCAGGUCGUAA-3'
- Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’41. The following 9 TRNAS have anticodon loop regions that base pair with the mRNA in the ribosome. Using your knowledge of tRNA-MRNA base pairing and the genetic code chart (+lecture slides), indicate the MRNA codon message being read by the ribosome as well as the1-letter amino acids that is generated. Anticodon Anticodon Anticodon Anticodon 4 Anticodon Anticodon 6. 2 5'-IAG-3' 5'-UAU-3' 5'-АAА-3' 5'-CUC-3' 5'-GAU-3' 5'-AGA-3' codon MRNA 5'-__-3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 1 letter amino acid Anticodon Anticodon Anticodon 8 7 5'-CCG-3' 5'-GUU-3' 5'-CGC-3' codon 5'-__-3' 5' 3' 5' _3' mRNA 1 letter amino acid
- c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…38. in the human beta-globin, two introns are spliced out in order to produce the mature mRNAGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.