1. Calculate Simpson’s Index of diversity for butterflies in habitats B and C, by pooling all samples within a habitat (as shown on the slide) 2. Explain, in no more than 100 words, why there may be differences in butterfly diversity between habitats A, B and C.
Q: 30 Laat time you give me wrong answer plz don't do like this give me exact answer plz ? Plz i really…
A: The correct answer is 5) No more dangerous than the seasonal flu.
Q: A sample of 100 individuals from a population that is dimorphic at the A locus has genotype counts…
A: According to the Hardy-Weinberg equilibrium the allele and genotype frequencies will remain same…
Q: Explain in 1000 words, the role of sewage treatment in hospitals (1500 words)
A: Introduction :- To prevent water pollution from discharges of raw sewage, sewage treatment is a sort…
Q: Which of the following is NOT true? cleaners that cheat more frequently are avoided more often…
A: Explanation: Age-related changes that occur when the jelly-like substance (vitreous) in your eyes…
Q: Come up with a short (<15 bp) genome sequence and a k value that would result in multiple possible…
A: DBG (DE BRUJIN GRAPH) A de Bruijn sequence of order is a cyclic sequence of length where each…
Q: Chloroplast features I. can synthesize store both carbohydrates and some forms of lipids II.…
A: Introduction Photosynthesis is one of the process through which the plants obtain energy. It is…
Q: 1) Which primer could be used as the forward primer, for synthesizing DNA from left to right in the…
A: PCR is a technique that utilizes the concept of DNA replication via the usage of enzyme polymerase…
Q: VI. Pathologic pseudostratified columnar epithelium: Bronchitis VI. Pathologic nonkeratinized…
A: The stratified squamous epithelial cells that lack the keratin protein are called the nonkeratinized…
Q: If PCR is unsuccessful, how do you adjust the following parameters and why would you adjust them…
A: PCR is a vital technique in the fields of molecular biology and biochemistry. However, sometimes PCR…
Q: Question A friend presents to you a rare male calico cat. Which statements are false? This cat is…
A: Calico cat The calico male cat are also called as unicorn of the cat.
Q: Classification a. Compare and contrast the three domains of life in Woese's classification system.…
A: The evolutionary links between species are referred to as phylogeny. The Three Domain System is an…
Q: Select ALL of the following that are involved in photosynthesis. Calvin Cycle ✓ Photosystem…
A: Explanation: There are two types of photosystems in photosynthesis: Photosystem I and Photosystem…
Q: Please rewrite the objectives below as SMART objectives Help cancer patients feel better when they…
A: The given question is asked to rewrite the objectives in a more convenient way. We have to assume…
Q: Given the following genome: G C G C G C G C G C A G A G A G A G Construct a De Bruijn graph…
A: De Bruijin graph shows sequence in its k mer form. It can be created in long and short sequence.…
Q: Histologic abnormality features:
A: Celiac disease is related to digestive problem which affects small intestine. This disease will…
Q: What are three major methods of transmission of the HIV virus and provide an example of each method.
A: HIV stands for Human Immuno deficiency Virus and is responsible for causing AIDS in humans. HIV…
Q: Determine the diversity of the animal community in the pond using the Shannon Diversity Index.…
A: Species richness is the number of animal species in the pond animal community. Species diversity is…
Q: A medicine has a clearance of 200 ml/min and a volume of 100 L. After a day, it is decided to double…
A: Steady-state concentration (Css) occurs when the amount of a drug being absorbed is the same amount…
Q: needed a smart objective made from that statement. Not the steps to reduce cardiovascular disease.
A: Cardiovascular diseases are the type of diseases that occur due to anomalies in the working of…
Q: 2. Conducted at 100 m/s, an action potential in the above neuron would travel 1 m in 10 ms. In the…
A: Introduction Action potentials, those electrical impulses that go throughout your body, are nothing…
Q: 3. A tan-colored female mouse is crossed with a white-colored male mouse. All of the male offspring…
A: According to the experimental results, Mendel discovered that the gene pairs originate from both the…
Q: JURNAL Linus Pauling: Creativity and Controversy in Science and Society MAIN IDEA: With creativity,…
A: Linus Pauling made important discoveries in the field of Molecular Biology, chemistry and…
Q: Enzymes are dependent upon proper structure for their function. Please name 3 factors that can…
A: A biological catalyst is an enzyme. While they quicken or speed up a process, they are actually…
Q: What possible experiments can be done to examine whether Agrius convolvuli is the selective agent…
A: Introduction: The common name of Agrius convolvuli is hawk moth. This is commonly found in Africa…
Q: Explain the barriers to interbreeding separate populations as the basis for the evolution of new…
A: A species is defined that can only breed with other organisms of the "same species." There are…
Q: Cell Transport Concept Map requires Word Bank: Active Transport Passive Transport Diffusion Against…
A: Cell membrane Cell membrane or plasma membrane is a selective permeable membrane or semipermeable…
Q: should muscles fatigue faster at higher or lower frequencies?
A: Muscle fatigue is defined as a decrease in maximal force or power production in response to…
Q: Will all of the light wavelengths be absorbed or reflected equally? What is the purpose of the…
A: No not all the light is absorbed or reflected completely. If the light of particular wavelength is…
Q: An object is utilizing kinetic energy when it is in motion. True O False
A: The given statement is absolutely true. The correct answer is option A. True. An object utilizes…
Q: Please explain how the catabolism of ATP supports the anabolism of protein.
A: *Catabolism the the process of breakdown of complex molecules into simpler forms and releases…
Q: COMPLETE THE TABLE Basic Characteristics Specialized features Hemichordata Chordata
A: Coordinates and hemichordates are coelomates , deuterostomea triploblastic animal
Q: The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’…
A: Introduction: A bacterial protein termed restriction enzyme, also known as restriction endonuclease,…
Q: Complete the illustrations that show the differences between mitosis and meiosis.
A: Introduction Cell division is referred to as the process in which the genetic material is divided…
Q: Provide a paper published in a scientific journal between January 2018 and September 2022 that…
A: Zhao and Shilatifard Genome Biology (2019) 20:245 https://doi.org/10.1186/s13059-019-1870-5…
Q: can you Explain in 1000 words, the role of sewage treatment in hospitals?
A: The operation of a sewage remedy plant approach that you could have one hooked up nearly anywhere,…
Q: IV. Pseudostratified columnar epithelium - normal IV. Pathologic simple columnar epithelium - Celiac…
A: Simple columnar epithelia are tissues made of a single layer of long epithelial cells that are often…
Q: Please write a brief summary about What is the life history of the endangered great hammerhead…
A: Sharks have been around for nearly as long as any other species, at 450 million years old. They have…
Q: A figure of the energy payoff phase of glycolysis is shown below. Look at the reaction labelled with…
A: Glycolysis is the first step of cellular respiration that occurs in both presence and absence of…
Q: Use the pedigrees below to answer the corresponding. What is the most likely mode of inheritance for…
A: A pedigree is a family chart showing the inheritance of a particular trait through several…
Q: 10. This tiny animal, a rotifer, "breathes" by absorbing oxygen directly through its skin and…
A: Rotifer Rotifers are microscopic organisms with pseudocoelomatic body organization.
Q: Ten years into the future and you have just become a parent of a new born baby who apparently…
A: A newborn screening (NBS) test is performed to find out various genetic, developmental, and…
Q: 1.5 Cells without cell walls •Cell wall essential in shape and integrity of the cell •Lysis (Fig…
A: The science of cell structure and function is known as cell biology, and it is based on the idea…
Q: e novo synthesis of building blocks always requires Group of answer choices A and B A. precursor…
A: Introduction :- The process of converting inorganic nitrogen compounds found in the environment into…
Q: Match the following: Adult stem cells Embryonic stem cells Induced pluripotent stem cells Cells from…
A: Introduction :- In the second stage of embryonic development, the blastula develops. After…
Q: Which pathways will work to raise blood glucose levels? Which do not?
A: Energy metabolism is the process through which living cells get and use energy to live, develop, and…
Q: give answer asap dont copy from anywhere please thank you
A: The taster and nontaster traits are related to the ability to taste the chemical called…
Q: Which type of PCR (End-point PCR, RT-PCR, qPCR)is used for diagnosing Covid-19 patients? Why is this…
A: Covid 19: The SARS-CoV-2 virus is the infectious disease known as coronavirus disease (COVID-19).…
Q: The body of a man contains 49.5 L of water. He drinks 0.5 L of pure water. Suppose that all of this…
A: Introduction :- The number of osmoles of solute per litre of solution is the unit of measurement for…
Q: What are the advocacies that you can do to or personal initiative to help in the mitigation of…
A: The quantity of fossil fuels consumed, aerosol discharges, and land transformation through farming…
Q: H+ flow down their gradient from the intermembrane space into the mitochondrial matrix through…
A: *Electron transport chain consists of a series of protein complexes and other molecules which…
1. Calculate Simpson’s Index of diversity for butterflies in habitats B and C, by pooling all samples within a habitat (as shown on the slide)
2. Explain, in no more than 100 words, why there may be differences in butterfly diversity between habitats A, B and C.
Step by step
Solved in 4 steps
- Eco01091 2674 Pfol 46 BstAPI 179 Aatil 2617 Ndel 183 Sspl 2501 Ehel 235 Pdml 2204 Bogl 2215 Scal 2172 146/ lacz 406 MCS 236 409 PUC18/19 2686 bp Bsax 659 Sapl 683 852 LAlI, Pscl 806 Gsul 1784 1626 Cfr101 1779 Eco311 1766 Eam11051 1694/ rep (PMB1) \Cail 1217 \BseYl 1110 29 ATC COC GO0 TAC CA CT CAT G or E IST E CG CA ATT Oir M y e am m ens ccs e NG stt CGA ACG IAC GA CT CCA GCT GAG ATC TOC TAG GOG CCC RG CT CA GT TM GA an co a e A ec y Lael-WWa las A Lan Sr O a in A O N Sr Sr W Ne 1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. a. Pscl & Gsul b. Scal, Pdml & BsaXI c. Scal, Sspl & Ehel 2. You have determined that the amplicon you want to clone has enzyme restriction sites for Hindll, and ĘCORI, After investigation you have seen that the PUC18/19 plasmid 6…This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids020-2 b My Qu X All Cha Nazare Permis h BIO210 Co X Master Anator Chapte um.ecollege.com/course.html?courseld%3D156741508OpenVellumHMAC=54e94737743258a7158dac000d4797e4#10001 Chapte Q Upgra Q Ch. 4 FTables Table 1: Time Required for Methylene Blue Color Change Milk Sample Start Time/Date (Step 10) End Time/Date (Step 11) Time Elapsed (End Time-Start Time) 0 hours 12:00PM 2/14/2020 12:30PM 12/14/2020 30 minutes 1 hour 12.00 PM 12/14/2020 1:30PM 12/14/2020 1 hour 3 hours 12:00PM 12/14/2020 3:00PM 12/14/2020 3 hours 4 hours 12:00PM 12/14/2020 12:00PM 4:00PM 4 hours Which sample took the least time to become white? Why do you think this was the case?Σ P UTF-8"Chapter 12 Solutions 202 x 02-xythos.content.blackboardcdn.com/5b19550bob538/10621560?X-Blackboard-Expiration3=D1649052000 DWorksheet.docx Edits will not be automatically saved. aved changes MOu a Garamond 14. B. 三: 三 山 8. When placed in each of the following, indicate if a red blood cell will 1) not change 2) hemolyze 3) crenate 5%(m/v) glucose solution 1%(m/v) glucose solution 0.5%(m/v) NaCl solution 2%(m/v) NaCl solutionQuestion 1.Describe the challenges posed by COVID 19 pandemic by different countries considering their demographies. (800 words)Make a 1 paragraph awareness about the COVID-19 Pandemic.1) Analyse the following experimental set-up (illustrated in Figure 1) a) A wild-type (WT) bacterial strain is sensitive to the antibiotic X (Ant X) (Figure 1A) b) You have grown the WT strains in 3 independent liquid cultures (C1, C2 and C3) for 24 hours (Figure 1B-Passage 1) c) Following this initial growth, C1, C2 and C3 cultures are subcultured in 9 independent cultures and grown for 24 hours (Figure 1C Passage 2). Subsequently, cultures are plated on Non-Selective (N/S) solid media and media with Ant X (+ Ant X). The number of colonies grown in each plate are shown (Figure 1C) Use the above information to discuss: a. the type of mutations (if any) that have been arisen during the experiment. b. When did the mutations arise Question continues on the next pageEnumerate five (5) reasons why you think the number confirmed COVID-19 cases is continuously increasing. Give one (1) significant reccommendations to resolve each reasons.10:36 PM ...0.2KB/s A O & 14 35 (IUII LUILIVII) LUI CUILIVIT by Chegg There are solutions for 279 problems: CH15 2RQ Explain the influence of natural selection on a. the virulence of tuberculosis. b. bacterial resistance to antibiotics. c. the changing degree of genetic diversity in an HIV population during infection. Step-by-step solution: We don't have a solution to this problem yet. Select a different problem. Back to top See solutionsPlease don't copy holding a population of microorganisms (having a z value of 19 ᵒF) at 231 ᵒF for one minute has the same lethal effect as holding the population at 250 ᵒF for the following minutes: (select the correct answer – answers may be rounded). **ANSWER IS NOT 1.08 CHOICES- IT IS ONE OF THESE 0.13 0.39 0.51 0.28 0.10 0.15 0.07 1.72 0.21 2.15 2.05 ACOVID-19 1 X My account x C Broward Pa x Opportunit X ZG Application X e ADN37-HIX sevier.com/#/content-player?assessmentVtwld=afcd4cb0-17dd-4437-82f1-ce5cb069ddf9&instanceld-bundle_2207609 on.com - Onli... Imported From IE b * ? 0 Other bod New Tab Question 7 of 24 The client is wearing thigh-high antiembolic hose prescribed by the Healthcare provider (HCP). The nurse assesses the client's legs every 8 hours. Which assessment finding reflects signs of possible thrombophlebitis that should be reported to the HCP? Paresthesia. Decreases hair growth in lower legs. Negative for pallor. Unilateral calf edema. EHESI Case X +SEE MORE QUESTIONS