1. The figure below shows the ribosome elongation cycle in translation. Label the features indicated in the bubbles provided: GTP next round oooooooo EPA START codon recognition 3' GDP GDP translocation activation of GTPase GTP GDP GTP ΕΡΑ ooooooa GTP hydrolysis GTP hydrolysis GDP ooooooo GTP EPA EPA GTP tRNA rejection (start over) accommodation ΕΡΑ peptidyl transferase ΕΡΑ What is wrong with this part of the figure?
Q: 2. An enzyme-catalyzed reaction has a Km = 120 μM. At what substrate concentration would this…
A: In enzyme kinetics, the Michaelis-Menten constant, or Km, is a parameter that characterises the…
Q: In a transition state diagram, which of the following are features of the transition state (TS)?…
A: Q.Explanation:- Transition state:- Transition state is an intermediate state when a reactant is…
Q: The toxic effect of Na+ ions can be avoided in some plant species by storing them in membrane-bound…
A: One kind of active transport that moves Na+ ions through a membrane is the Na+/H+ antiport…
Q: As a result of the rotation about its six bonds, DNA can exist in a variety of forms. Determine…
A: There are 3 major DNA variants. They are A-DNA, B-DNA and Z-DNA. In all these variants, A pairs…
Q: he Lineweaver-Burk plot, which illustrates the reciprocal of the reaction rate (1/v) versus the…
A:
Q: An alpha-helix transmembrane protein has 35 amino acid residues embedded in a lipid bilayer…
A: The repeating unit of an alpha-helix is the helix turn. Each helical turn in alpha-helix has an…
Q: One way of expressing the rate at which an enzyme can catalyze a reaction is to state its turnover…
A: Kcat, or turnover number is the number of substrate molecules converted to product at one active…
Q: A tetrapeptide was analyzed with carboxypeptidase, the results from the analysis are found in the…
A: There are four classes of biological macromolecules- proteins, nucleic acids, lipoproteins and…
Q: All of the following statements about the citric acid cycle are true except: O The citric acid cycle…
A: Metabolism is defined as the chemical reactions involved in maintaining the living state of the…
Q: Determine whether each of the carbohydrates is a monosaccharide, disaccharide, or polysaccharide.
A: Carbohydrates are biomolecules that comprise carbon, hydrogen and oxygen atoms. The hydrogen-oxygen…
Q: Calculate to three decimal places the charge on a-melanotropin at pH value of 5. Express your answer…
A: Net charge on the amino acid with negative side group: Net charge on the amino acid with positive…
Q: membrane potential of a neuron drops to -55mV and sodium ions start to flow from outside to inside…
A: This question can be calculated by Nernst equation. This equation provides the relationship between…
Q: The second messenger cyclic AMP (CAMP) is synthesized from ATP by the activity of the enzyme…
A: Some signalling molecules cannot diffuse across the biological membranes so they communicate their…
Q: If a liver extract capable of carrying out normal metabolic reactions (including gluconeogenesis) is…
A: The metabolic pathway that converts non-carbohydrate metabolites like pyruvate into glucose is known…
Q: Cyclic photophosphorylation uses two photons to generate one ATP. If the AG of ATP hydrolysis is -50…
A: Percent efficiency is defined as a measure of the manner in which how efficiently a process or…
Q: Transport of histidine into a bacterial cell was measured at several different histidine…
A: The kinetics of transport of a molecule via a carrier protein and a protein channel differ from each…
Q: Lipids t
A: Organic compounds referred to as lipids exhibit a wide array of characteristics owing to their…
Q: [2] Calculate the pH of the arginine solution after the addition of Oml, 5ml of 0.1M NaOH and…
A: A method employed in laboratories for calculating an amino acid's pKa values and isoelectric point…
Q: In the diagram below, the orange circle represents an effector and the dark purple shapes (both the…
A: An allosteric effector, also referred to as an allosteric regulator, is defined as a molecule which…
Q: (c2) Identify the active site residues that make hydrogen bonds and electrostatic interac- tions…
A: In order for an enzyme to properly bind its substrate and catalyze the reaction, several binding…
Q: Given the following peptide SEPLMAPVEYPK TABLE 5.1 Properties of the common amino acids found in…
A: pKa is the pH at which the weak acid is 50% dissociated.When pH < pKa of the ionising group, the…
Q: 3.) The enthalpy change associate with a biological process is -13200 cal/mol at 298K and +14700…
A: The heat capacity of a system is the amount of heat that must be supplied to a system to raise its…
Q: Assume a fragment of two-stranded antiparallel β-structure is 3.3 nm long. What is the approximate…
A: Deoxyribonucleic acid also known as DNA, is a molecule that houses the genetic instructions required…
Q: Suppose that each ß-adrenergic receptor bound to epinephrine converts 100 molecules of the Ga…
A: Biochemical signal transduction pathways taking place within lifeforms have the ability to amplify…
Q: NaCl (s)-> NaCl (aq) is accompanied by an increase in entropy because [Select] [Select] a solute was…
A: Entropy:Entropy can be defined as the measurement of randomness or disorderness in the thermodynamic…
Q: After completing your analysis of the different bacterial methyltransferases at MethylTranspharmiX,…
A: Enzyme kinetics constitutes the scientific exploration of the intricate mechanisms underlying how…
Q: 1) Phosphatidate composed of octadecanoate fatty acids 2) Phosphatidate composed of hexadecanoate…
A: The graph given below shows the fluidity of membrane. The degree of bilayer fluidity depends on…
Q: Draw the Fischer projections of the four aldotetroses. Draw the D-sugar on the left and its L-isomer…
A: There are four classes of biological macromolecules; proteins, nucleic acids, carbohydrates and…
Q: At pH ___, the pentapeptide AEHVC would contain two positively charged groups and one negatively…
A: Recall that:Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: 1) The approximate length of a DNA double helix is around 0.34nm per base pair. If the extracted D…
A: 1) A somatic human cell has 23 pairs of chromosomes, that is 46 pieces of DNA. The combined length…
Q: As described in 4C above, PLP-dependent enzymes can generate formaldehyde from serine. This compound…
A: Protonation/deprotonation is a common step in biochemical reaction. Enzymatic reactions can proceed…
Q: Which of the following will result from the binding of one O₂ to a molecule of hemoglobin? the…
A: When one molecule of oxygen (O2) binds to a molecule of hemoglobin, it triggers specific…
Q: You are characterizing a new DNA polymerase. In a test tube, you incubate the enzyme with all the…
A: DNA is a molecule made up of two strands twisted around each other in a double helix shape. Each…
Q: Chymotrypsin is a digestive enzyme with a catalytic optimum between pH 7.8 and 8.0. However, due to…
A: Proteases are enzymes that cleave peptide bonds that link two amino acid residues together.…
Q: 1a. If you wanted you could take a glucose molecule and convert it to pyruvate via glycolysis and…
A: Hello! Due to time constraints, we are able to provide the answer for the first sub part only. If…
Q: Which mutation will most likely cause the mutant or protein to misfold in terms of thermodynamics.…
A: Mutations are the permanent change in DNA sequence. These changes may occur naturally or by inducing…
Q: Which of the following amino acids could work as the catalytic residue in an enzyme active site?
A: The distinguishable feature of an enzyme is the active site of the enzyme. Enzyme catalysed…
Q: The turnover number is defined as the maximum number of substrate molecules that can be converted…
A: An essential parameter in enzymology that evaluates an enzyme's catalytic effectiveness is the…
Q: Representations of sequencing chromatograms for variants of the a chain of human hemoglobin are…
A: The sequencig chromatograms given in question are generated as we conduct Automated DNA sequencing…
Q: had a response from a peer and this is what they said: You mentioned that aliphatic amino acids…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: Consider the fatty acid. Which of the designations are accurate for the fatty acid? 6-3 fatty acid…
A: Fatty acids are carboxylic acids having long chains of hydrocarbons attached to them. It is…
Q: CO,+H20+ HCO3 → H+ + HCO3
A: Here, we are given the reaction taking place in the bicarbonate buffer. Blood plasma is buffered…
Q: Vitamin K questions a) What transformation of glutamate side chains is Vitamin K (as its reduced…
A: Vitamin K is essential for blood clotting. Vitamin K in it's reduced form (Vitamin KH2) is active,…
Q: Label blood types O and B with the correct monosaccharides. The defining monosaccharide is noted by…
A: AB blood typing gives rise to 4 main types of blood groups, which are A, B, AB and O. There are 3…
Q: how do telomeres protect against replicative shortening
A: Telomeres occur as repetitive regions found towards the end of a chromosome. Telomeres occur in a…
Q: The protein catalase is an enzyme that catalyzes the decomposition of hydrogen peroxide: 2 H2O2 (aq)…
A: For a one-substrate enzyme reaction, the Michaelis-Menton equation shows the quantitative…
Q: You analyze a protein of 100 kDa using SDS-PAGE in the absence and presence of �-mercaptoethanol…
A: Multisubunit proteins are composed of more than 1 polypeptide chain.SDS (sodium dodecyl sulfate)…
Q: This question has been posted previously with parts A B and C already answered. Please focus on only…
A: Amino acids classified as hydrophobic have side chains (R groups) that have a propensity to resist…
Q: Order the following steps of muscle contraction: Drag and drop options into correct order and…
A: The action potential is initiated and propagated through the motor neurons to finally reach the…
Q: You identify a section of 2 beta strands in a protein crystal structure. When you identify the…
A: The linear arrangement of amino acids in beta strands, an usual secondary structure in proteins,…
fill in the bubbles
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
- The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
- 30. Below is a pre-mRNA sequence that contains 2 exons and an intronic region. Based on your knowledge of the spicing reaction, predict the ligated exon sequence. [ | (hint: there is a consensus sequence for this "cut n paste' rxn.] 5'-ACGACAGGAUGAAGGUAAAUCGGGUAGGGGCGGCUGACUCUCUUUUUCCCUCAGGUCGUAA-3'Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
- Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd GTable 8.2 Codons in mRNA molecule and their corresponding amino acids UUU UUA GCA AAG GOU O nonsense Oleucine Refer to Table 8.2. UAU codes for which amino acid? O lysine O alanine Phenylalanine UAU leucine UAA alanine lysine valine UCG, UCU O tyrosine AAU UGC tyrosine nonsense asparagine cysteine serine