1. What mRNA sequence does the following DNA template sequence produce? DNA 3-TACGTATAATTGACATTTGATCTTATGACT-5¹ mRNA: 5¹- Write out the one letter code for this peptide then produced by this mRNA upon translation: peptide: N- -C -3'
Q: Answer the Questions below: 1. Based on the experiment above, what is the means of detecting the…
A: Lipids are hydrophobic compounds that are usually made up of an alcohol backbone and a long chain…
Q: Could you please explain in detail why they end up in aspartate? Illustrations with 14C labelled…
A: All the metabolic reactions occurring inside the living system provides energy and replenishes the…
Q: c) 1.0 1.2 Estimate Vmax and KM for all cases. What type inhibitor is [I]? Estimate K₁ and/or Kı'…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion…
A: DHFR fusion protein: The enzyme known as dihydrofolate reductase, or DHFR, reduces dihydrofolate to…
Q: Which two statements below accurately describe the roles of insulin and glucagon in maintaining…
A: Glucagon is a hormone secreted by the pancreas that controls the blood glucose level. It prevents…
Q: A sample of yeast extract has been analyzed of its invertase activity. The effect of temperature on…
A: Invertase is the enzyme that catalyze the hydrolysis of sucrose in fructose and glucose. Sucrose is…
Q: Which of the following monosaccharide phosphates is NOT produced in the pentose phosphate pathway?…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
Q: Identify: for nos. 1-5: Name of the missing metabolite in the pathway 6-10: Enzyme that catalyzed…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: Which of the following statements is correct regarding the structures below? CHO CHO H-OH ОН H-OH -н…
A: Monosaccharides are the simplest carbohydrates. Based on the functional groups, they are classified…
Q: create a concept map revolving around the topic nucleic acids. Use at least twelve (12)…
A: Nucleic acids are large biomolecules which plays important role in expression, storage and transfer…
Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…
A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are bio molecules that are made up of fatty acids and glycerol. They are insoluble in water…
Q: The ff: table showed data of enzyme catalytic reaction. The rate of reaction (v) decreased with the…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Please explain this table (just the endothelial cell density)
A: Endothelial cells are a single layer of cells that lines all the blood vessels, lymph cells,…
Q: Write a description of the physical characteristics of the isolated starch and glycogen. Provide the…
A: Starch and Glycogen are Polysaccharides, made up of many units of monosacharides. Starch is reserve…
Q: Chemistry what is the correct method for protien purification if the PI of three protiens are:…
A: The proteins are composed of twenty naturally occurring amino acids that are connected via peptide…
Q: Detection of the enzyme aminotransferase in the blood is used to diagnose: kidney damage pancreas…
A: Aminotransferases, also called as transaminases are enzymes that catalyze the transfer of…
Q: 32. During a study of insulin response, a healthy nonobese 24-year-old woman consumes four pancakes…
A: When subjected to a prolonged period of starvation, the level of glucose in the blood falls. This…
Q: Which of the following first messengers is hydrophobic and binds to a nuclear receptor protein…
A: The first messengers are extracellular biomolecules that bind to the cellular receptor and elicit a…
Q: 5. Arrange the following fatty acids in order from lowest melting point to highest: myristic acid,…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: What is the total number of moles of ATP generated per mole of glucose in the glycolytic pathway and…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: In making the experiment of protein denaturation, what usually happens upon, precipitation of strong…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: true/false: Transamination reactions yield an a-keto acid and an amino acid.
A: The amino acids undergo reactions like transamination and deamination. As the name suggests the…
Q: Explain how gluconeogenesis ang glucogenolysis are regulated to maintain blood glucose levels during…
A: Gluconeogenesis is the process of transformation of non-carbohydrate substrates ( lactate, amino…
Q: 4. Identify: for nos. 1-5: Name of the missing metabolite in the pathway 6-10: Enzyme that catalyzed…
A: Catabolism is the breakdown of complex substances into simpler molecules, while anabolism is the…
Q: 5. Describe the role of His in the catalytic mechanism shown.
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Draw the electron pushing mechanism
A: Electron pushing mechanism shows the jumping of electrons in the substrate and/or reaction…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CACGGGG-3'
A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…
Q: Please help me calculate BSA and Net Abs (explaination and details pls)
A: Bovine Serum Albumin (BSA) is the most commonly used protein in research. It is obtained from the…
Q: Two (2) moles of GALACTOSE are completely oxidized to CO₂ and water using the malate-aspartate…
A: Glycolysis involves a series of reactions that convert glucose into pyruvate with the production of…
Q: Metabolic Integration Q9.1: Glucose-6-phosphate is a key metabolic intermediate in four major…
A: Glucose-6-phosphate is the key metabolic intermediate where it is branched to four major metabolic…
Q: The structure of purine is shown. 2 N-1 N-3 N-7 N-9 6 5 N 4 3 7 N -N9 ZI 8 Which atoms of the purine…
A: Purines: The two groups of nitrogenous bases, which also include the two groups of nucleotide…
Q: Write a short description of the physical characteristics of acid & enzymatic hydrolysates. What…
A: Introduction: The principle of the benedict test is that when reducing sugars when heated in the…
Q: Several of the enzymes of glycolysis fall into classes that What reaction participate in many other…
A: Enzymes are classified into different classes based on the nature of type of reaction they catalyse.…
Q: Substrate phosphorylation in the tricarboxylic acid. (TCA)
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: 4. Compare regulation by allosteric control, reversible covalent modification, and proteolytic…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: The pentose phosphate pathway occurs in the mitochondrion of tissues actively engaged in synthesis…
A: Introduction: The pentose pathway is also known as the hexose monophosphate shunt (HMP) or…
Q: We eat foods containing sucrose (table sugar), lactose (milk sugar), and cellobiose (disaccharide of…
A: Carbohydrates that are obtained through the diet include monosaccharides, disaccharides, and…
Q: Another key component of lipids is a fatty acid. A fatty acid is recognizable by its carboxyl group.…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Uncouplers of oxidative phosphorylation are all expect: Select one: O a. thermogenin O b.…
A: INTRODUCTION: (Oxidative phosphorylation) The process by which ATP is formed as a result of the…
Q: Think of an additional application of the Disk diffusion method based on your experience and…
A: Disk diffusion method is a culture based microbiological assay technique in which bacteria is grown…
Q: The structure given below represents what molecule?
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Consider oleic acid (18:1D9): How many rounds of beta oxidation will omit the enzyme acyl-CoA DH?
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Identify the reasons why the DNA molecule you selected would lead to DNA synthesis. It is…
A: An important characteristic of DNA replication is that it is semiconservative. Two strands of DNA…
Q: Based on what is known about the mechanism of Chymotrypsin, which molecules would be inhibitors of…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 4. Peculiarities of hormonal regulation of glycogen metabolism in muscles and liver.
A: The glycogen synthesis mainly occurs in the muscle, and liver, using glucose-6-phosphate. The…
Q: The inhibitor X prevents coenzyme Q (Q) from participating in electron transfer in the electron…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: calculate the [PNP] in μM for each of these samples.
A: Molarity is way of representing the concentration of a solution. Molarity is number of moles of…
Q: 4. Blood glucose level, glucose transporter proteins (classification, localisation and biological…
A: Blood Glucose is the major sugar found in our blood.It is the main source of energy used by a cell.…
Q: Give the following information about the "Protein Banding Pattern" - Methodologies - Advantages -…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Step by step
Solved in 2 steps with 1 images
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bpThe following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
- A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine30. Below is a pre-mRNA sequence that contains 2 exons and an intronic region. Based on your knowledge of the spicing reaction, predict the ligated exon sequence. [ | (hint: there is a consensus sequence for this "cut n paste' rxn.] 5'-ACGACAGGAUGAAGGUAAAUCGGGUAGGGGCGGCUGACUCUCUUUUUCCCUCAGGUCGUAA-3'A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
- The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
- c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’