Answered: 1c) T. aquaticus genomic DNA is 34.3%…

1c) T. aquaticus genomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine nucleotides? 1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 Fraction of DNA

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: 1.0 MS2 T4 E. coli 0.5 104 103 102 10- 10' 102 103 10* 1 Cot (mole x sec/L) b.) This next figure…

A: he cot curve is depicted in the diagram above. It explains the process of dentauration. The double…

Q: 18. Choose the correct number of DNA molecules created after 6 cycles of PCR. a. 6 b. 16 c. 32 d. 64…

A: Introduction The polymerase chain reaction (PCR) is a widely used method for rapidly making…

Q: 1. An image of a DNA profile is shown below. The size marker fragments are not shown, but the size…

A: STR stands for Short Tandem Repeat . This analysis is a common molecular biology method. It is used…

Q: In the next gel, in lane I is the marker. Estimate the sizes of DNA fragments (in base pairs, bp)

A: Electrophoresis is the migration of charged particles under the influence of electric current.…

Q: 1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What…

A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…

Q: How can you modify your DNA model to reflect changes among DNA molecules?

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: 1. Which of the following is the correct order for the steps in DNA extraction? I. Precipitation of…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we are…

Q: I T?L|| ?L||?T |||| || |A| ||T|||c| |||| 6 4 5 “A. Denote the 5' and 3' ends of all of the DNA…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: 10. In the diagram below, Transcribe the two new complementary strands of DNA. ,ΑTIGCCAAGT…

A: According to the question, we have seen a diagram, where we have to transcribe the two new…

Q: 1. What is the function of the electrophoresis buffer? 2. Why did you mix your samples with loading…

A: Gel electrophoresis: it is a technique used to sepals different fragments of different lengths of a…

Q: 2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…

A: mRNA stands for messenger RNA which is a single stranded RNA molecule that is complementary to one…

Q: 6. Shown here is a hybrid of DNA and RNA. Label which one is which. What do the blobs represent? 7.…

A: Hybrid of DNA: RNA is considered a key regulator of gene expression and genome stability.

Q: 1. Calculate the size of the resulting fragments as they will occur after digestion and write the…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: Answer the following Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’…

A: The central dogma depicts the flow of genetic information into cells, the replication of genomic…

Q: 1. Predict the following sequences of base in the DNA strands complementary to the single DNA…

A: DNA is a polymer of nucleotides attached together via phosphodiester bonds. DNA acts as genetic…

Q: 30.Match the definition with one of the choices on the right (can be used more than once) Place with…

A: DNA or deoxyribonucleic acid is the main molecule that is responsible for the purpose of storing…

Q: 6.d. Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’ Complementary DNA sequence:…

A: Replication is the process of formation of identical copies of DNA. It occurs in nucleus.…

Q: 9. Create a matching (complementary) DNA sequence for the following strand: A A A A A C CGA CCGATC

A: DNA is known to be the largest biomolecule in the cell. It is composed of two polynucleotide chains…

Q: 1. Explain why DNA fragments can be separated using an electric current. How does the size of the…

A: 1.DNA fragments can be separated by the application of current this process of separating DNA occurs…

Q: Need to understand how to do this: create the complementary strand of DNA to the DNA strand provided…

A: DNA is a double helical structure that comprises of tel strand running in opposite directions. Both…

Q: 2. Use the plasmid to answer the following questions: [6T] a) Digest the plasmid with EcoRI only and…

A: The restriction enzymes are used to make nicks at certain positions on the DNA. These positions are…

Q: 11.Fill out the following table by adding the complementary RNA and DNA basses. NA NA А G C

A: Answer: Nucleic bases are the nitrogen containing compounds such as adenine , guanine , thymine ,…

Q: How many subunits does E. Coli DNA polymerase I have? 5 10 1 3

A: The DNA polymerase I helps in replication,repair and recombination of DNA. E.Coli has 5 sub units of…

Q: state why simplicity and speed are top priorities in selecting DNA isolation method

A: * Deoxyribonucleic acid that is isolation is the extraction process of DNA from other sources. * The…

Q: Which is the correct pair of DNA with a strand of 3’-TTT-GGG-AAA-5’? A 5’-AAA-CCC-TTT-3’ B.…

A: DNA (Deoxyribose Nucleic acid is a double-stranded helical molecule that carries information for the…

Q: 1. Differentiate between D & L sugars? 2. RNA not exists in double stranded from as DNA. Why?

A: A sugar is a polyalcohol with at least one of them oxidized to either an aldehyde or a ketone. As a…

Q: (LO 2.8) Think about antiparallel alignment of nucleic acids and complementary base pairing. The 5'…

A: From the given options the correct answer is the option 5’- AGATC - 3'.

Q: Damaged DNA can be reversed if nucleotides can be replaced with a proper nucleotide for a correct…

Q: #4 under End Result: Two identical strands of DNA are made. Each strand has one of the original…

A: The above-given diagram shows the process of DNA replication and the structure of DNA during the…

Q: Which of (a)-(d) is complementary to the DNA segment 5'-ATGAGCCAT-3'? * O 5'-TACTCCGTA-3' O…

A: Deoxyribonucleic acid: The replication of DNA involves the production of new molecules that have a…

Q: 1. Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Answer: 2. Draw the…

A: In a complementary base pairing, purine pairs with a pyrimidine. A always pairs with T, similarly C…

Q: 8. Discontinuous DNA replication generates short fragments of DNA called Okazaki fragments.Which…

A: Since there are multiple questions, we will answer the first one for you. If you require a specific…

Q: A. What is the relationship between the DNA molecular weight and the distance travelled by DNA…

A: DNA is a genetic material and compose of nucleotide bases, ribose sugar and phosphate. It is used in…

Q: 4) Repetitive DNA comprises about _________ of chromosomal DNA A) 5% B) 40% C) 60% D) 95%

A: DNA is the genetic material in most living organisms. It carries information for synthesis of all…

Q: 15. Which of the following statement is Not true? a) Plasmids are circular DNA molecules b)…

A: A plasmid is a small extrachromosomal DNA molecule which can replicate independently.

Q: 9. Explain why DNA fragments move through a gel at different rates. (A2)

A: A technique called gel electrophoresis is used to separate DNA fragments (or other macromolecules,…

Q: 1 Corals are animals that live on the sea bed. The photograph shows some species of coral. (a)…

A: Introduction A coral reef is an underwater ecosystems that is characterised by corals that construct…

Q: 4. Draw the actual map of the PMBBS plasmid, following the style of the sample map shown in Figure…

A: Restriction enzymes: Restriction enzymes are also called molecular scissors. These are named so…

Q: Explain the following relationship: DNA formats RNA, which makes proteins.

A: DNA and RNA are two types of nucleic acids. DNA provides the code for the cellular activities while…

Q: 2.Fill in the blank with the best answer. If band 3 (6 kB) in lane 5 contains 280 ng of DNA, then…

A: Fill in the blank the question. Average weight of one DNA base pairs= 650 Dalton. 1 Dalton =…

Q: (kbp) (bp) 4. To the right is an image of an agarose gel. Lanes 1 and 4 are DNA markers (DNA sizes…

A: Agarose gel electrophoresis is the process by which DNA fragments are run on the basis of their…

Q: Polynucleotides beginà end are: a) 5’ à 3’ b) 2’ à 5’ d) NH2 à CO2H

A: Polynucleotides are formed by nucleotides in DNA or RNA. A nucleotide is formed by nitrogenous base,…

Q: 3' 5' a 5' 3' C f 5' 3' 3' 5' What enzyme should be at location "c" to synthesize DNA after the…

A: DNA replication is the process by which cell makes new copies of the DNA molecule.

Q: 45.) What is the complementary strand for the DNA sequence 5'- CTAAAG-3'? B) 5'- CTTTAG-3' A) 5'-…

A: Complementary deoxyribonucleic acid is a kind of DNA in which the constituent molecules on one…

Q: Make simple steps to extract isolating DNA from strawberries and yeast.

A: Answer

Q: Forensic investigations: Compare the DNA collected from the crime scene to determine which of the…

A: DNA fingerprinting utilizes the unique DNA fingerprints present in the human genome. These are…

Q: .If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding…

A: DNA replication is a process in which new copies of DNA is made.The mode of DNA replication is…

Q: b Two short DNA segments are AGCC and CCGA. Are the two segments identical? Yes No Submit

A: DNA ( Deoxyribose nucleic acid ) is ladder like double stranded structure which comprises of two…

Q: 9. Describe the effect on the protein chain if base pair #20 in the parent DNA chain is missing. 10.…

A: The majority of living organisms have DNA as their genetic material. The genetic information is…

Question

1c) T. aquaticus genomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine nucleotides?
1
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
Fraction of DNA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

A double-stranded DNA molecule (B-DNA) is 100,000 base pairs long. How many complete turns are there in the molecule? * None of the above 10000.0 9090.0 9523.8 O 8333.3
T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine nucleotides?
Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.
7. What are the 4 nitrogen bases? 1. 2. 3. 4. 8. What is their purpose? Why does their order matter? Answer in complete sentences. How does this structure allow a DNA molecule to be copied to make another identical molecule? The answer to this question is that the nitrogen bases interact with one another in predictable ways. Pairing between nitrogen bases on opposite strands is always the same. Notice that the pairing that takes place between nitrogen bases is specific in DNA strands. Adenine, a large base, bonds with thymine, a small base. Guanine, a large base, bonds with cytosine, a small base. This specific bonding pattern that happens between the nucleotides is called complementary base pairing. 9. How do the bases pair? How are A and G similar? How are T and C similar?
12:49 0 14. You want to amplify the DNA between two stretches of sequence shown in the figure below. Explain which one of the following primer pairs would allow you to amplify the DNA by PCR. DNA to be amplified 5'-GACCTGTGGAAGC -CATACGGGATTGA-3" 3'-CTGGACACCTTCG GTATGCCCTAACT-5" primers (1) 5'-GACCTGTCCAAGC-3 (2) 5-CTGGACACCTTCG-3 (5) 5-CATACGGGATTGA-3" (6) 5°-GTATGСССТААСТ-3° (3) 5'-CGAAGGTGTCCAG-3' (7) 5'-TGTTAGGGCATAC-3" (4) 5'-GCTTССАСАGGTC-3° (8) 5'-TCAATCCCGTATG-3' END 5 THE END
1.0 MS2 T4 E. coli 0.5 104 103 102 10- 10' 102 103 10* 1 Cot (mole x sec/L) b.) This next figure compares the DNA from two bacteriophages (MS2 and T4) and a bacterium (E. coli). The genome sizes are as follows: MS2 3569bp; T4 168, 903bp; E. coli -~4. 600, 000bp. i. Describe the relationship of the three different curves to each other. ii. Explain this relationship in terms of genome size. c.) When half of the DNA in the sample is double-stranded, that point is termed the half- reaction time (Cot12). Plot a graph below that describes how genome sizes of MS2, T4 and E.coli affects the half-reactioh time. Fraction remaining single-stranded (C/Čo)
A double-stranded DNA molecule is 1 cm long, and the percentage of adenine is 15%. How many cytosines does this DNA molecule contain?
Show the replication strands in each of these bubbles (note they have different DNA orientations). Label each end of each DNA strand and include arrows to show which direction it is extending. Show the Okazaki fragments in the correct places. 3' 5'
ii) Assume that the following polynucleotide is part of a longer DNA molecule. Write out the product that would be obtained from its replication.3 AAGCTTTCCG
A DNA sample contains 21% adenine. What is the complete percentage base composition?
For each term in the left column, select the term which best matches. 1. deoxyribonucleotide 2. nitrogenous base thymine + deoxyribose 3. deoxynitronucleoside guanine + deoxyribose + phosphate group 4. polydeoxyribonucleotide DNA 5. deoxyribonucleoside 6. nitrogenous base
Select the incorrect statement w.r.t. double helical structure of DNA. 1. The two chains of DNA run in anti-parallel fashion 2. The backbone is constituted by sugar-phosphate 3. The nitrogenous bases project outwards 4. Guanine is bonded with cytosine with three H-bonds