2. Antibiotics a. Candida albicans is a eukaryotic yeast that can cause thrush and vaginal yeast infections. Why can't you treat an infection with this microbe with erythromycin or streptomycin? Please be specific - Because b. You are working to develop drugs that can target bacterial infections or fungal infections. Please describe 2 differences in the cell wall structure that could aid in cell-specific drug development. "
Q: How are we able to distinguish between the two (above) life cycles on a bacterial lawn?
A: Introduction Bacteria are prokaryotic, or single-celled, creatures that are virtually ubiquitous on…
Q: Table of Staphylococcus aureus and it should contain the following details. Clinical…
A: The natural Habitat is Mammalian body surfaces . They are seen on the normal flora of the body and…
Q: Find the average eccrine gland density (total /3)
A: Eccrine gland It refers to the sweat glands that are present on almost all areas of the skin. This…
Q: Discusse what is Bioecological Systems Theory. Explain each system part of the theory : Microsystem,…
A: Introduction The bioecological model is based on the notion that children's relationships with…
Q: what do you think is the coolest metabolic process for energy-producing nutrients?
A: All living organisms require energy for various living processes such as growth, reproduction,…
Q: In a double blind clinical trial for a drug neither the subjects nor the researcher knows who is in…
A: Introduction In a double-blind trial, neither the volunteers nor the researchers are aware of who…
Q: What are Human-Made Chemicals and Pollutants ?
A: A material that is present in concentrations that could be harmful to creatures (including people,…
Q: A controlled experiment. LLL. O is repeated many times to ensure that the results are accurate O…
A: Controlled experiment is test which is directly changed by a experimentalist as to test one variable…
Q: How does tRNA move through the 3 sites of the ribosome (in what order)
A: tRNA or the transfer RNA is the adaptor molecule possessing a clover leaf-shaped structure due to…
Q: Students are performing an experiment to understand the transfers of carbon between a photosynthetic…
A: BTB is a pH indicator, it is of blue colour and as the pH decreases or the solution becomes acidic…
Q: If the TD50 of a drug is 20 mg, it means that: Answers A-D A 50% of patients experience toxicity at…
A: In toxicology, the toxicity and therapeutic effects of the drug must be analyzed before finally…
Q: For most cell types, serum must be added to the media to get cells to grow and proliferate in…
A: In humams serum is the plasma without clotting factors. Which means that plasma contains antibodies,…
Q: Our policemen and soldiers help the city to be in its proper shape, ensuring the city is in order.…
A: Introduction Inside cells, organelles are specialised structures that carry out a variety of tasks.…
Q: 24. Examine the graph to the right. Is the reaction depicted exothermic or endothermic? Explain your…
A: Activation energy The energy required for any reaction to proceed forward to make product. If this…
Q: Function of animal's skin for reproduction
A: Sexual reproduction is the process of reproducing through the uniting of male and female gametes.…
Q: Make a dichotomous key of these animals: Cockroach, Dogs, Cats, Grasshoppers, Bees
A: Cockroach Dogs Cats Grasshoppers Bees 1. Wings absent Wings present Go to 4 Go to 2…
Q: How is pancreatic enzyme secretion regulated?
A: Pancreatin or pancrelipase, a combination of amylase, lipase, and protease, is a component of…
Q: Importance of functional groups in biological system with at least two examples?
A: Introduction When a molecule contributes in a living organism's biological reaction or process, it…
Q: Are fern spores haploid or diploid? Are the spores proudced by meiosis or mitosis? Where are the…
A: The majority of ferns are homosporous, with spores on each plant being the same size and form, often…
Q: In a diploid organism, Meiosis 1, and line up at the metaphase plate during Mitosis. line up at the…
A: Mitosis is essential in embryonic development because it allows a single-cell zygote to grow into an…
Q: Relate the role of hemoglobin and insulin in one of the functions of proteins.
A: Introduction : Proteins are large molecules made up of the building blocks known as amino acids.…
Q: which of the following does not have enzymatic properties? OB-galactosidase sucrase cellulase…
A: Introduction :- As an enzyme, β-galactosidase breaks down lactose disaccharides to provide galactose…
Q: The letters below represent genes found on different chromosome pairs. Letters that are similar…
A: Genotype refers to the alleles or variants of an organism's gene in a particular locus of a…
Q: A phage that reproduces slowly, produces relatively few phage particles, and only undergoes the…
A:
Q: Illustrate the development of colorectal cancer ?
A: Any of the several illnesses characterised by the growth of aberrant cells that divide out of…
Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…
A: The simplest definition of gene expression is the production of the gene's complementary protein,…
Q: Initially, she may present her data and condusions at a scientific conference whe tists. Later, she…
A: Science is the coolest subject that revolves around every testable and prediction around the world.…
Q: The tickle response can also trigger escape movements, increased heart rate and tears. What type of…
A: Introduction The neuron, a specialised cell created to send information to other nerve cells,…
Q: You are conducting an experiment studying sex linked traits. I. The experiment you cross 2 different…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Which of the following is a function of lipids? (Select all that apply.) Question 8 options:…
A: Lipids are biomolecules that are insoluble in water but soluble in organic solvents. They include a…
Q: LEU VAL HIS VAL Write the nucleotide sequence of the template strand that corresponds to these…
A: Transcription Synthesis of mRNA from DNA Translation Converting genetic information into…
Q: G1 phase after S phase after meiosis I after meiosis II n ploidy # of chromosomes per cell # of DNA…
A: Cell division occurs in two stages: mitosis and meiosis. Mitosis is the process of creating new body…
Q: How does porin protein regulation work?
A: Introduction :- Porins are beta barrel proteins that act as a pore through which molecules can…
Q: What happens, metabolically, to the body id the lactate is not cleared from the muscles?
A: Introduction Oxygen and nutrients are heavily used by muscle tissue. Its consumption is undoubtedly…
Q: What is the purpose of an intermediate host for parasite replication? Why have some organisms…
A: Intermediate host and a Definitive host are important stages of reproduction of Parasites.…
Q: 1. Read through each procedure below and BRIEFLY describe the procedure in one-two sentences. Be…
A: Answer : Reducing sugars are any carbohydrates that contain a free aldehyde or ketonic group that…
Q: Some silent mutations have been found to be associated with disease. Suggest a possible mechanism…
A: Introduction : The DNA sequence varies from species to species. Base-pair sequence alterations are…
Q: Which of these groups is characteristic of thiols? B O A OD OC -В -D E
A: Thiol It is a functional group of sulphur and hydrogen atoms (—SH).
Q: Carbohydrates are the same thing as sugars. A single glucose molecule is an example of a monomer…
A: Introduction The substances in food known as nutrients give us the energy needed for development,…
Q: Please take the following sequence of DNA and perform 1) DNA Synthesis, 2) Transcription, and 3)…
A: According to Central dogma of Molecular Biology there is undirectional flow of information from DNA…
Q: In oogenesis--> other than allowing for the elimination of one half of the diploid chromosomes, what…
A: Introduction : Small cytoplasmic exclusion bodies called polar bodies develop to contain extra DNA…
Q: 6. Do all outer cell membrane surface receptors bind G-proteins? 7. What is an example of a hormone…
A: Cellular receptors are proteins either inside a cell or on its surface, which receive a signal.
Q: How do we know that cancer cells often contain defects inDNA repair?
A: Introduction Cancer is a popular disease now a day. In the US, 1 in 2 women and 1 in 3 men develop…
Q: Give a detailed description of the structure, characteristics, and functions of carbohydrates . Then…
A: Introduction Plant foods tend to be high in carbohydrates. As a milk sugar known as lactose, they…
Q: How does mitosis result in daughter cells containing identical number and same DNA with its parent…
A: Introduction Mitosis is the name given to the cell division process that produces two new daughter…
Q: What is the function of the stigma in protists such as Euglena and Chlamydomonas? As the world's…
A: Introduction : Algae are living organisms that are found all over the earth. They develop in a wide…
Q: describe implantation of a blastocyte using simple label diagrams.
A: Introduction : In males, the parent organism creates a haploid sex gamete known as sperm, and in…
Q: order to reduce the social and economic burden, therapeutic methods to ND, such as AD and PD, should…
A: The paragraph is all about the cause of various neuro degenerative disease and the treatment plan.…
Q: List one advantage and one disadvantage of conjugation in Paramecium: Advantage: Disadvantage:
A: Introduction Conjugation is a process by which one bacterium transfers genetic material to another…
Q: Instructions: Consider the following information and complete the three possible phylogenetic trees.…
A: Introduction A phylogenetic tree is a branching diagram or tree that depicts the relationships that…
Please do both part
Step by step
Solved in 2 steps
- 16. Why 70% alcohol is used as a disinfectant? Circle all possible explanation. O A. Alcohol denatures proteins in the plasma membrane or viral body thus destroying it rendering them ineffective and causing cell death or inhibiting reproduction. V B. Water is used as a catalyst for the denaturation of proteins that leads to cell membrane destruction. O c. Alcohol can be taken in orally, destroys cells that entered the body. V D. Diluted alcohol evaporates slower compared to a pure alcohol since its highly volatile, providing more time for chemical reactions to take place. O E. 100% alcohol coagulates proteins instantly creating a film that protects the other proteins from further coagulation preventing other alcohol molecules to react and destroy the cell membrane. O F. Alcohol has a dehydrating effect and may interfere with the functioning of cell membranes.a. If viruses that normally form envelopes were prevented frombudding, would they still be infectious? Why or why not?b. If only the RNA of an influenza virus were injected into a cell byitself, could it cause a lytic infection?a. If you were involved in developing an antiviral drug, what wouldbe some important considerations? (Can a drug “kill” a virus?)b. How could multiplication be blocked?
- i. What is Viroid how these viruses infect plant cells? How it differ from animal virus? iv. If you are asked to culture virus how it proceeds and which type of conditions will be needed to grow virus cells? v. Which type of sterilizing agents can be used in preservation of animals cells/tissues? How can we kill all types of microbes and which types of techniques can be used?1. Precise words:Find the nonspecific terms in the following sentences. Replace the nonspecific choices with more preciseterms or phrases (It is not necessary to change the sentence structure).(i) All OVE mutants showed enhanced iP concentrations.(ii) Plants were kept in the cold overnight.(iii) To provide proof of concept for our hypothesis, we studied a virus in its host cell.(iv) The present paper reports on continuing experiments that were performed to clarify thissurprising effect.(v) The first transition state is a little lower in energy than the second transition state. 2. Simple words:Improve the word choice in the following examples by replacing the underlined terms or phrases withsimpler word choices (do not change the sentence structure).(i) These data substantiate our hypothesis.(ii) The difference in our results compared to those of Reuter et al. (1995) can be accounted forby the fact that different conditions were used.(iii) For the purpose of discussing cell migration we…viruses:1. Why must primary cell cultures be restarted every so often when preparing primary cell cultures to observe morphological changes caused by cells infected by a virus? Why are tumor cells preferred? 2. Why are non-enveloped viruses generally more resistant to disinfectants than are enveloped viruses? 3. A public health physician isolated large number of phages from rivers used as a source of drinking water in western Africa. They physician is very concerned that humans might become ill from drinking this water, although she knows that the phages specifically attack bacteria. Why is she concerned?
- Can you please help me..... 1. Protective capsule is? 2. Outer covering surrounding capsid of some viruses is? 3. Two forms of growth? 4. Gelatinous covering of microbe? 5. Long filament of cells? 6. genetically different cells within species? Thank youA B 12. The cells (above, A) were growing in the presence of "Drug X". After several hours the larger cell appears to deflate (B). What is the most likely target for Drug X? A. capsules B. peptidoglycan C. ribosomes D. cell membrane E. biofilms20. Viroids and prions: a. Compare viroids and prions in terms of structure and host.b. Describe how prions accumulate in nervous tissue and the appearance of the brain that has been infected with prions.
- O t of Match the type of pathogen with the correct description. Prions Virus Protozoans Bacteria and parasitic worms Choose... Choose... Can be treated with drugs that prevent it from synthesizing proteins Misfolded version of a harmless protein that will cause host cells to produce misshapen proteins May cause damage by releasing a toxin into the bloodstream Can only replicate when it is inside of a host cell Choose... Fia. During which stages of an infectious disease does the host exhibit signs and symptoms? Is there a correlation between this and when a disease is communicable? b. Why are some viral diseases, like smallpox and polio, no longer seen in the United States? Why are many bacterial disease, like syphilis, no longer a death sentence? Think about how these two types of microbes infect humans. Why might we make an effort to treat viral diseases before infection but continue to treat bacterial diseases after infection? c. Based on the graph below, which pathogen is more virulent: Agent 1 or Agent 2? Explain. 100 Agent 1 LD5 = 400, Agent 2 LD50 = 600 25 100 200 300 400 500 600 700 800 900 1,000 Dose (organisms administered per animal) Percent mortality 75a. Škin rashes Increased white blood cell count Preventing Disease weakened or killed pathogens used to an 1. response (usually a shot) 2. blocking the growth and reproduction of bacteria (usually pills) Controlling Bacteria 1. -subjecting bacteria to high temperatures chemical solutions that kill bacteria 2. 3. refrigerating, boiling, frying, and steaming food Examples of Bacterial Diseases 1. Disease - carried by ticks, red dot 2. -contraction of skeletal muscles 3. Throat - cough and spots in back of mouth 4. Viruses What is a Virus? Viral Structure disease causing particle Capsid (protein sheath) RNA Envalope protein 1. 2. No -DINA Envelope structures (nucleus, cytoplasm, ,or cell membrane) Proteins Capsid 3. Requires a 4. No cellular 5. Can be called a cell Enzyme Bacteriophage Tobasoo mosalo viruA (TMV) Human Immunadsficiency virus 0V)