Q: What is a sarcomere? What is labeled Z,H, and M, and what are their functions? In the contracted…
A: introduction:- Muscle fibres are specialised cells that make up the muscular system. Its ability to…
Q: During transcription, only some of the DNA bases are transcribed. What parts of the DNA or/and…
A: Transcription is the first step in gene expression, the process by which genetic information is…
Q: Briefly describe the good harvesting practices to optimize the post-harvest quality of fresh fruits…
A: Good harvesting practices plays huge role in maintenance of quality of fresh fruits and vegetables…
Q: Which is true about Archaeopteryx (select the best possible answer)? A. it was a dinousaur b. It…
A: Introduction Evolution is the shift in the genetic makeup of biological populations over numerous…
Q: Consider a cell that has four pairs of chromosomes. During meiosis I, how many different chromosome…
A: Introduction :- Meiosis I is a type of cell division that occurs in the formation of sperm and egg…
Q: What terms would best describe the above coupled reaction? A. it is non-spontaneous and endothermic…
A: Introduction :- Endothermic refers to a process or reaction that absorbs heat, resulting in an…
Q: research medical conditions? Can you explain the technology distinctions between face-to-face and…
A: Today web or internet offers each and every type of information ready on the platter. It is upon the…
Q: Readings and review on the Methods of Estimating Evapotranspiration and Consumptive Use
A: Introduction Evapotranspiration (ET) is the process by which water is transferred from the land and…
Q: 1) Visualization and 2) Electrophysiological
A: To monitor the trafficking of AMPA receptors during LTP, we can design an experiment using the…
Q: 29d e f h please
A: Introduction: Energy and metabolism are closely related concepts in cellular biology. Metabolism…
Q: | 11. Fill in the correct answers below. e. A specific example of a carbohydrate monomer is: ANSWER…
A: Macromolecules are large, substances made up of repeating components such as carbohydrates, lipids,…
Q: In point form, describe and explain how the organelles listed play a role in each major function in…
A: Protein synthesis, also known as protein biosynthesis, is a fundamental biological process that…
Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…
A: Introduction : One of the earliest steps in gene expression is transcription. The transfer of…
Q: 4 Identify the phylum (or supergroup) to which this organism belongs AND identify its mode of…
A: Phytoplankton are microscopic, photosynthetic organisms that float in aquatic environments and form…
Q: Which of the following statements is true about the above diagram? the signal molecules bind to the…
A: The correct answer is the third option.
Q: How
A: Introduction: A biosensor is a device that uses biological components, such as enzymes, antibodies,…
Q: Drosophila females heterozygous for three recessive mutations, a, b, and c , were crossed to males…
A: Drosophila females heterozygous for three recessive mutations, a, b, and c, were crossed to males…
Q: A. Examine the following pedigree chart. Complete the missing labels and answer the questions that…
A: Introduction :- A pedigree is a graphical representation of the genetic and ancestral relationships…
Q: Discuss how to isolate and purify cells and proteins.
A: The protein purification is the process by which a protein is isolated from a complex mixture, which…
Q: estion 29 ( Which of these could be the sex chromosome makeup of a person whose cells have Barr…
A: Female have two X chromosomes and males have sex chromosomes in the form of One X chromosome and one…
Q: Provide 5 non-membranous organelles and their functions
A: Organelles are compartments in the cells which perform specific functions. The organelles carry out…
Q: Xeriscaping Research
A:
Q: 9. For the following organisms, rank them by the probable percentage of unsaturated phospholipids in…
A: Phospholipids are the Lipid molecules possessing a Phosphate head which is hydrophilic and fatty…
Q: Define substrate level phosphorylation. How does 1,3-bisphosphglycerate relate to substrate level…
A: Introduction: Substrate-level phosphorylation is a mechanism of ATP formation. there is transfer…
Q: Compare and contrast infectious disease and microbial intoxication. Give examples of each.
A: The illness in the body of human, animals and plants are known as disease.
Q: f you diluted 200 uL of your culture into 1800 uL of water what is your dilution factor? (Show your…
A: A dilution factor is a ratio that represents the change in concentration of a solution after it has…
Q: What 2 aspects can you observe in this animal DNA that indicates that it is the regulatory part of a…
A: Transcription is a process by which DNA is transcribed into RNA. Transcription in eukaryotes takes…
Q: 2. How can parasites (helminths & protozoa) be possibly spread from an infected person to healthy…
A: The term "parasite" refers to an organism that depends on its "host" in order to survive. Some…
Q: 3. What health teachings can you give to the donor of the fecal sample who was found to have these…
A: The donor of a fecal sample has been found to have parasites, which can cause a range of health…
Q: Explain the uses for the different media types used to subculture media: Broth: Deeps: Slants:
A: ANSWER) Different culture medias are used to grow the bacteria in the particular medium. Broth,…
Q: The Microscope: Care and handling A. Introduction B. Principle C. 3 Use AND STATE 3 USES…
A: Microscope is a device that magnifies small objects, giving the user a close-up view of minuscule…
Q: An individual with genotype Dd Ee Ff will produce (——- )? different types of gametes. If an Ss Rr…
A: Introduction :- Gametes are specialized cells that are produced during sexual reproduction and are…
Q: Rank the options below. Separation of homologous chromosomes Synapsis Random orientation of…
A: The process by which the parent cell duplicates its genome and eventually divides into two or more…
Q: Which of the following enzymes at the bacterial replication fork hydrolyze ATP for their activity?…
A: Introduction :- DNA primase, a type of RNA polymerase, is an enzyme that aids in DNA replication. A…
Q: rowth medium contain. ophosphate expression of the lac op
A: Introduction: The lac operon is a genetic control element found in bacteria that regulates the…
Q: strains of Drosophila that have either normal legs or abnormally short legs and you are studying the…
A: Law of dominance says that dominant character is expressed in two conditions either in homozygous…
Q: Vasopressin is a hormone that is mainly released when the body lacks water. The release of…
A: Vasopressin is a hormone that plays an important role in regulating fluid balance in the body. It is…
Q: Task 4 A. For the following genotypes state the ABO blood phenotype. |A|A_ |B10_ 191⁰- |A|B_ B.…
A: INTRODUCTION ABO Blood grouping system : Invented by Karl Landsteiner. It consist of four blood…
Q: gentic drift is A. genetic change in an indivdual's lifetime b genetic change over time c. The…
A: The analysis of genes, including how they function inside cells and how they are passed down from…
Q: A laboratory measuremere sinds 100 µg of hemoglobin per jal. of blood. Hemoglobin the blood protees…
A: Red Blood Cells (RBCs), also known as erythrocytes, are the most abundant type of blood cell and are…
Q: rite a short descri eating, but has be
A: Introduction: The nephron is the functional unit of the kidney and is responsible for filtering…
Q: What structures or features do all protists have in common?
A: All eukaryotes that are not fungi, animals, or plants are categorised as protozoa, or protists.…
Q: Distinguish between a solute, solvent and a solution
A: Solute, solvent and solution are important terms in biochemistry and Chemistry. These are very…
Q: a rice species low high diverged six five whole genomes gene families homologous genes Duplication a…
A: Gene: The term "gene" has a variety of meanings in biology. The molecular gene is a sequence of…
Q: Define the medical term 'dysrhythmia' and list 7 modifiable causes of dysrhythmias.
A: Introduction: An erratic heartbeat is known as a cardiac arrhythmia. When the electrical signals…
Q: Compare and contrast viruses’ Lytic and Lysogenic replication cycle
A: Viruses are small infectious agents that only replicate inside the living cells of other organisms.…
Q: A 1.5-year-old child developed vomiting, diarrhea, and fever. Stool sample were inoculated into the…
A: Introduction :- Agar is a polysaccharide obtained from red algae that is commonly used as a…
Q: Sister chromatids are linked together by their centromeres. True or False
A: A condensed form of DNA is known as Chromosome. The main parts of chromosomes include chromatids,…
Q: if you have a two allele system, how many genotypes can you have
A: Alleles Alleles are alternative forms of a gene that occupy the same locus on a chromosome. An…
Q: What is the efficiency of the metabolic conversion of palmitic acid to ATP? The standard free energy…
A: Introduction Saturated fatty acids such as palmitic acid have the molecular formula C16H32O2. It is…
![2.Explain the basis for the pH scale](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F83200500-b6a2-4bc0-99d3-023f9c3e43df%2F07e15c38-0201-42a3-8c3d-537fb71f378f%2Fa5tnc63a_processed.png&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
pH is a measure of how acidic or basic a substance is. It is measured on a scale from 0 to 14, with 7 being neutral. A pH less than 7 is acidic and a pH greater than 7 is basic.
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- 1. Calculate the pH of a buffer solution made from 0.20 M CH3COOH and 0.50 M CH3COO- that has an acid dissociation constant for CH3COOH of 1.8 x 10-5.2. Calculate the pH of a buffer containing 0.1 M sodium acetate and 0.2 M acetic acid (pKa = 4.76).2. Four unidentified solutions of equal concentration (0.1 mol/L) were prepared by chemistry students who were investigating the properties of acids and bases. Solution Red litmus Blue litmus pH Conductivit Blue No change 13.2 Very high 2 No change Red 3.5 Weak 3 No change Red 1.8 Very high 4 Blue No change 10.7 Weak Identify the acids and the bases in the list above. b. Classify the acids and the bases as being weak or strong with supporting information. Suggest another test that could be used to determine the relative strengths of the acids.
- 4. A 100-mL buffer solution with pH of 4.80 is prepared as a stock solution. Using this stock buffer solution, three buffers are prepared by diluting a given volume of the stock buffer (as shown below) to 100 mL with water. Volume used from Buffer Final volume, mL original solution, mL 1 5 100 2 10 100 20 100 a. Do they have the same pH? Check the box corresponding your answer. O Yes O No HY 47.1 Basic Biochemistry, Laboratory b. Which is true about their absolute concentrations? Check the box corresponding your answer. [Buffer 1] > [Buffer 2] > [Buffer 3] [Buffer 3] > [Buffer 2] > [Buffer 1] [Buffer 3] = [Buffer 2] = [Buffer 1] [Buffer 3] = [Buffer 2] > [Buffer 1] [Buffer 3] > [Buffer 2] = [Buffer 1] c. Which is true about their concentration ratios? Check the box corresponding your answer. [Buffer 1] > [Buffer 2] > [Buffer 3] [Buffer 3] > [Buffer 2] > [Buffer 1] [Buffer 3] = [Buffer 2] = [Buffer 1] [Buffer 3] = [Buffer 2] > [Buffer 1] [Buffer 3] > [Buffer 2] = [Buffer 1] %3! %3D d.…2. You are given 575mL of a .200M solution of NaOH and are adding 600mL of water What is the new concentration?1.Write the equation for the dissociation and re-formation of water
- 4. In a solution, the medium in which atoms/ions/molecules are dispersed is the and the dispersed substances are called the pH Scale1. What volumes of 50 mM CH3COOH and 30 mM NaCH3CO0 solutions are needed to prepare 2L of 20 mM acetate buffer pH 3.6? (pka for acetic acid is 4.74)4. A buffer can protect against changes in pH when hydrogen ion or hydroxide ion is added to a reaction mixture. Explain the reason.
![Cardiopulmonary Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781337794909/9781337794909_smallCoverImage.jpg)
![Biology: The Unity and Diversity of Life (MindTap…](https://www.bartleby.com/isbn_cover_images/9781337408332/9781337408332_smallCoverImage.gif)
![Cardiopulmonary Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781337794909/9781337794909_smallCoverImage.jpg)
![Biology: The Unity and Diversity of Life (MindTap…](https://www.bartleby.com/isbn_cover_images/9781337408332/9781337408332_smallCoverImage.gif)