#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Q: The recognition sequence for the restriction enzyme TaqI is T↓CGA. Indicate the products of the…
A: Restriction enzyme is a protein that recognizes a specific, short nucleotide sequence and cuts the…
Q: Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is…
A: Restriction digestion is a process in which DNA is cut into smaller pieces at specific sites with…
Q: Complementary DNA strand of 5'-ATTCGTATTCCCGCGGTGCAAC-3' OA.) 5-TAAGCATAAGGGCGCCACGTTG-3' OB.) 3-…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…
A: Primer is short sequence which is complementary to the base sequence of DNA and is considered to be…
Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…
A: According to the question, we have to answer the question that which is for the chromatograph below,…
Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…
A: The ds DNA strand between position 20-30 3'- GATACGCGATG- 5' The sequence of primer that will be…
Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…
A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…
Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…
A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…
Q: Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
A: In the question a DNA sequence is given with its nucleotides. Restriction enzyme is an enzyme that…
Q: Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is…
A: pUC18 plasmid is a derivative of the pBR322 plasmid, but its size is smaller when compared to…
Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…
A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…
Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…
A: Transcription is the process by which the information contained in DNA is converted into a…
Q: A researcher wants to cut this piece of linear DNA. 5'…
A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…
Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…
Q: Which of the following sequences, when combined with itscomplement, would be clipped by a…
A: Restriction endonuclease is also known as restriction enzymes that are produced by the bacteria.…
Q: Coding With the given coding strand perform the following 1. supply the correct non- coding strand…
A: DNA is a double helical molecule.
Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…
A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…
Q: Shown here is a DNA sequence. Which strand is the template?…
A: There are two types of strands in transcription process of the eukaryotic DNA Template strand…
Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…
A: Given:
Q: 3. You want to insert a sequence in the lacl gene to alter its function, what restriction enzyme(s)…
A: Introduction: The lac operon is a polycistronic structural gene controlled by a promoter and a…
Q: The recognition site for Spel is A'CTAGT. Which of the following restriction sites when digested…
A: Restriction site - Each restriction enzyme identify specific sequence of nucleotide, known as…
Q: Suppose that a geneticist discovers a new restriction enzyme in the bacterium Aeromonas ranidae.…
A: Restriction enzymes or restriction endonucleases are the enzymes that cut the DNA strand at specific…
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…
Q: SspI --- 5' AAT - ATT 3' 5' GGATAATATT GTTAACAATCTCTACGGGTTAACACCCTTGGAATATTTTAA 3' 3'…
A: DNA is one of the two nucleic acids made up of monomer units of nucleotides. DNA nucleotides are…
Q: The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction.…
A: Sanger sequencing (also known as chain termination sequencing) is a DNA sequencing technology that…
Q: Use the (non-template) DNA strand below to determine which is the promoter/sigma binding region:…
A: Introduction: A promoter is a DNA sequence to which proteins bind to start transcription of a single…
Q: Another restriction enzyme is called HaellI. It cuts DNA at the following base sequence: CCGG GGCC…
A: restriction enzymes are those enzymes which helps in cutting dna at specific locations .
Q: Need help with question one
A: The plasmid is the extrachromosomal DNA present in the bacterial cell. These are the extra DNA other…
Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…
A: DNA stands fo deoxyribonucleic acid. It is the genetic material.
Q: The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the…
A: Introduction Plasmid Vectors: these are like the artificial vehicle to deliver our gene of insert…
Q: The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′…
A: The mutant gene produces when there are changes in the sequence of nucleotides in the wild type…
Q: If the Hinfl restriction enzyme recognizes G^ACTC sites, as seen in the image, belUW. GACTC How many…
A: The cloning of DNA is the mechanism by which a certain fragment of DNA is multiplied. The selected…
Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical…
A: ANSWER;- Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content =…
Q: Please determine the relative location of the three restriction enzymes. Enzyme Number of fragments…
A: Restriction enzymes are a type of enzyme that can detect and cleave a certain short sequence of…
Q: Describe the process for shotgun sequencing of a genome. Practice aligning the two sets of sequenced…
A: Since you have posted multiple questions, we solve the first question for you. To get the remaining…
Q: The following sequences of DNA would be synthesized using 5′-CAGTTCGGA-3′ as a template: *…
A: DNA is synthesized in 5' to 3' direction.
Q: plz explain with thorough explanation
A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a…
Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…
A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…
Q: List the sequences of RNA that would be transcribed from the following DNA template sequences.…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. It contain genes that…
Q: Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of…
A: Restriction enzymes are those that cleave the double stranded DNA at specific site. They have…
Q: If the recognition sequence of the restriction enzyme Hindlll is AAGCTT, then how many covalent…
A: The enzymes that are able to cut the DNA at specific sites are known as restriction enzymes. The…
Q: #2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC…
A: Restriction enzymes is an enzyme that cleaves DNA into fragments. Recognition sequence is a unique…
Q: The recognition site of some restriction enzymes are shown. Which will produce sticky ends? A.…
A: Restriction enzymes also known as restriction endonucleases are the enzymes which acts on the…
Q: How many statements are right? 1. operator is a protein (transcription factor) that interacts with a…
A: Operators are the sequence that is present on the DNA and controls the gene regulation. The…
Q: 8. You have a piece of DNA with the sequence shown below.…
A: EcoRI is one of the most commonly found restriction endonuclease and it is isolated from the E.…
Q: The restriction enzyme Haelll has the recognition sequence below and cuts between the G and bases.…
A: restriction enzymes are the specific endonucleases that have a specific site within the DNA sequence…
Q: The recognition sites for the restriction enzymes BamHI, Xbal, and Bglll are G^GATCC, T^CTAGA, and…
A: Since it is the multiple choice question i will provide answer in next step.
Q: The double stranded DNA sequence of a restriction enzyme cut site is typically complementary,…
A: Restriction enzymes are those enzymes which cut DNA by recognizing target sequences. Restriction…
Q: 3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’…
A: A restriction enzyme is a type of enzyme which cleaves DNA into fragments at a specific recognition…
#4 BamI --- 5’ CCTAG ↓G 3’
5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’
3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’
Restriction enzyme:
Recognition sequence:
Number of pieces of DNA:
Type of cut:
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- #3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
- EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
- b. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your response15/doc.aspx?sourcedoc={dac0ebeb-b019-4578-911c-98.. Search (Option + Q) Review View Help Table O Editing er Av A =position position (5' end) position (3' end) UUU Phe - F UUC Phe UAU Tyr Y. UAC Tyr UAA Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser U UUA Leu UUG Leu UCA Ser UCG Ser UAG Stop W 輔 CAU His CGU Arg CGC Arg CGA Arg CGG Arg CUU Leu CCU Pro CUC Leu CCC Pro P. CCA Pro CÁC His CỦA Leu CAA Gln CUG Leu CCG Pro CAG GIn AUU lle ACU Thr AAU Asn AGU Ser AUC lle ACC Thr -T ACA Thr AAC Asn_ AGC Ser AGA Arg AGG Arg A AUA lle AAA Lys EK AAG Lys AUG Met ACG Thr GUU Val GGU Gly GGC Gly GGA Gly GGG Gly GAU Asp D GAC Asp GCU Ala GUC Val -V GUA Val GCC Ala GCA Ala GCG Ala G - A GAA Glu FE GAG Glu GUG Val Nonpolar Polar Basic Acidic Stop codon Table 4.1 Biology: How Life Works, Third Edition © 2019 W. H. Freeman and Company Consider the DNA sequence–3'-CACTGGTAGCGA–5', • What is the sequence of the messenger RNA sequence that is transcribed from this DNA sequence? (Indicate the 5' and 3' ends of the RNA molecule.) • Consult the genetic code that is shown above. What is the amino acid sequence of the…Search (Option + Q) rences Review View Help Editing v A^ Dv A A A Question 1 During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 10 IV 12 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessiveEight mutant bacteriophage strains cannot lyse a certain type of bacteria that can be lysed by wild-type bacteriophages. The mutant strains were allowed to infect the bacteria in a complementation test. A "+" indicates that lysis occurred with coinfection. A "-" indicates that lysis did not occur. GKWTMAQC G- ++++- K W T M A Q C - + +++ - ++++ - + + - + - + - - + + + A cistron is defined by no complementation in the How many genes are controlling lysis in this bacteriophage? (Use a number not a word in the space) configuration.Eight mutant bacteriophage strains cannot lyse a certain type of bacteria that can be lysed by wild-type bacteriaphages. The mutant strains were allawed to infect the bacteria in a complementation test. A "+ indicates that lysis occurred with coinfection.Aindicates that lysis did not occur. GKWTMAQC G -++|+ ++l+ - K. - + - ++ +| + -+| - |-++ + + + M - + + + A cistron is defined by no complementation in the Ciş : configuration. Haw many genes are controlling lysis in this bacteriophage? (Use a number not a word in the space) 3 Which of the following strains below are defective in the same gene as strain Q? Answer yes if the strain is defective or no if it is not. Strain Defective A N/ASEE MORE QUESTIONS