6. Optimization of an analytical method is performed during validation. True or False?
Q: 1.0 0.9 Z 0.8 15. A pharmaceutical company studied the binding of three different compounds, X, Y,…
A: Compound Z has the strongest affinity for the protein. This is indicated by the higher fractional…
Q: 4nM 10 μΜ Ο 0.01 nM Ο Ο Ο 2 nM -2 nM
A: A Hill Plot is a type of graphical representation used in pharmacology and biochemistry to show how…
Q: Question 6
A: The question is asking us to identify a characteristic that is unique to sister chromatids during…
Q: For competitive inhibition: a. the value of Km decreases b. the value of Vmax decreases c. it is…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…
Q: Genetics Q3
A: The question is asking us to determine the percentage of Adenine (A), Guanine (G), and Cytosine (C)…
Q: 2.13 Calculate the reaction enthalpy, entropy, and free energy, AH°r, AS°r, and AGºr, for the…
A: Reaction thermodynamics is the energy things that occur during a chemical reaction together with a…
Q: Gleevec inhibits an enzyme needed in cancer cell proliferation. It acts by increasing the enzyme's…
A: Gleevec, also known by its trade name imatinib and internationally as Glivec, is an oral medicine…
Q: In N-linked glycoproteins, the sugar molecule is usually bound to a Asp b Ser c Asn d Thr
A: Glycoproteins are conjugated biomolecules where a protein is covalently bound to a carbohydrate…
Q: Tt O 8. What are the driving forces that promotes tertiary -3D and quaternary -4D structure…
A: Proteins are the biological macromolecules. They show great diversity in their structure and…
Q: Draw and label a diagram showing four DNA nucleotides, linked together in two strands. PLEASE DRAW…
A: Nucleic acids are biomolecules responsible for the storage and transmission of genetic information…
Q: Question 1: tRNA and amino acyl tRNA synthetases Part a: How many codons encode the amino acid…
A: Methionine is encoded by a single codon, AUG, which also serves as the start codon in protein…
Q: Describe how the shape and size of nucleotides are important in the structure of double-stranded…
A: Nucleotides that make up DNA are composed of 3 components; a deoxy ribose sugar, a phosphate and a…
Q: Genetics Q5
A: The term 'semiconservative DNA replication' refers to the process by which DNA replicates itself.…
Q: Identify which one among the 6 carbohydrates; Glucose, fructose, maltose, lactose, sucrose or starch…
A: CarbohydratesMolisch TestBenedict's TestSeliwanoff's testlodine testBial's testMucic acid…
Q: Genetics Question 15
A: Homologous pairs are pairs of chromosomes that possess genes for the same traits at corresponding…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: The DNA double helix has alternating major and minor grooves. The major groove is wider than the…
Q: Referring to the figure below, which letter (s) indicate (s) the site (s O a. A+B O b. Only B O c.…
A: Methylxanthines: They are a group of naturally occurring compounds like caffeine, theophylline, and…
Q: You have a peptide that has the following amino acid sequence: GPMG Draw the structure of the…
A: Peptides are short chains of amino acid residues that are linked together via a peptide bond. The…
Q: 24. Hexokinase catalyzes the phosphorylation of glucose from ATP, yielding glucose-6-P and ADP. The…
A: The objective of the question is to calculate the standard-state free energy change and equilibrium…
Q: 2. Peter does not tolerate lactose in milk. He bought a solution of ẞ-galactosidase where [Eo]=10.0…
A: To determine the initial rate of reaction (Vo) Vo = Vmax [C]KM +[C]…
Q: 2. The mature form of TEM-1 ß-lactamase, an enzyme of 290 amino acid residues that hydrolyzes…
A: Before calculating the isoelectric point (pI) of the enzyme, we need to be thorough with the…
Q: Genetics Question 7
A: The objective of the question is to identify the correct event that occurs during the prophase of…
Q: 4. a. For an exponentially growing population, calculate umax (units?) based on the data below Time…
A: Monod kinetics describe the relationship between the growth rate of microorganisms and the…
Q: The peptide below is placed into a buffer with a pH = 1.73 H3N-CH- CH2 NH—CH—C H3C-CH NH—CH—C NH—CH-…
A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…
Q: phosphorylation/dephosphorylation Diagram the cascade that regulates glycogen metabolism. Please use…
A: Glycogen synthesis is the process of synthesizing glycogen by polymerizing glucose. It is undertaken…
Q: Given the line-weaver Burke plot below for Enzyme Y, identify the Vmax for Enzyme Y. -10 30 1/v…
A: 0.056Explanation:To find the Vmax from a Lineweaver-Burk plot, we need to take the reciprocal of…
Q: The protein catalase catalyzes the reaction 2 H,O,(aq) — 2 H₂O(1) + O₂(g) S and has a…
A: Reaction: 2H₂O₂(aq) → 2H2O(l) + O2(g)Km = 25 mMTurnover number Kcat = 4.0 × 107s–1Total enzyme…
Q: Find the connection among the words below and choose the letter of the word which is different. A.…
A: Gel doc is an equipment most commonly used in molecular biology lab procedures for the visualisation…
Q: D. Explain why a protein (polypeptide chain) will assume a different 3-dimensional structure in: (1)…
A: The three-dimensional structure of a protein, also known as its native conformation, is critical for…
Q: 14. A protein mixture consisting of proteins A, B, and C was subjected to various protein…
A: The objective of the question is to determine the properties of proteins A, B, and C based on their…
Q: Q2
A: The objective of this question is to identify and explain two similarities and two differences…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…
A: The process of protein synthesis is also known as translation. The process of translation is…
Q: 7. Why proteins prefer to have a-helices or ẞ-sheets in their interior core, instead of random coil…
A: The preference for alpha helices and beta sheets in the interior core of proteins is driven by a…
Q: Choose the correct structure for thiamine hydrochloride at pH 10. H3C H3C N NH₂ NH₂ CI- `N A CI- с…
A: The relationship between pH and pKa is described by the Henderson-Hasselbalch equation:pH = pKa +…
Q: (a). The product of the reaction has two chiral centers as shown: The Ca atom of the amino acid…
A: To determine the L/D configuration of amino acids, place the alpha carbon () in the center, the…
Q: Carbamazepine is a lipid -soluble antiepileptic drug that has a larger volume of distribution in…
A: The objective of the question is to understand the effect of obesity on the elimination half-life of…
Q: Genetics Question 11
A: The objective of the question is to identify the stage of meiosis and the parent in which…
Q: Genetics Question 9
A: The objective of the question is to identify the event that occurs last during meiosis and the…
Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…
A: The objective of the question is to understand the relationship between the functional unit (FU) and…
Q: Provide a schematic representation of the reactions in the beta oxidation of an omega 6 fatty acid…
A: Beta oxidation is a fundamental metabolic process involving catabolism of fatty acids into energy as…
Q: How many dissociable protons are present in Tris buffer? How did you come to this conclusion?…
A: Tris buffer is also known as tris(hydroxymethyl)aminomethane. It is an organic compound with the…
Q: What is the major function of cholesterol esters? O Make cholesterol more hydrophobic so they can be…
A: Cholesterol esters are chemical compounds formed by the esterification of cholesterol molecules with…
Q: Free energy diagrams are super fun to draw! Draw a set of free energy diagrams that show the…
A: Free energy diagrams have free energy (G) in Y-axis and reaction coordinate in X-axis. These can…
Q: Which of the following statements is most accurate ? All statements are accurate All prescribed…
A: The objective of the question is to identify the most accurate statement among the given options…
Q: Melting Temperature (Tm) of a dsDNA molecule is the temperature at which a 100% of…
A: The correct answer is:c. 50% of the dsDNA exists in a single-stranded (denatured) form.…
Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…
A: The objective of the question is to understand the relationship between the functional unit (FU) and…
Q: Compute the free energy change in Joules that occurs at 303 K as the cell is tranitions from resting…
A: For free energy calculation, we can use the Nernst free energy equationi.e ΔG = -nF.ΔEWhere, ΔG =…
Q: When the CAC is run in reverse by microorganisms that use it to fix carbon, the citrate synthase…
A: Kreb cycle is the reaction procews that operates in the mitochondria and it is followed by…
Q: Proteins from which compartment of the bacterial cell are likely to be found in the supernatant…
A: The objective of the question is to identify which compartments of a bacterial cell are likely to…
Q: Draw the products of the reaction of xylulose-5-phosphate and erythrose-4-phosphate catalyzed by…
A: The Pentose Phosphate Pathway also known as the Hexose monophosphate shunt is a metabolic pathway…
STEM Workplace Practices Q6
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Describe the role of the “surprise” protocol in the experimentaldesign.Bradford Assay Fill in the average A595 and A595 of sample minus A595 of blank. Show some sample computation. Concentration (micrograms/ml) A595 - trial 1 A595 - trial 2 A595 - trial 3 average A595 A595 of sample minus A595 of blank 0 1.501 1.446 1.447 2 1.624 1.558 1.559 5 1.731 1.749 1.712 10 1.901 1.838 1.892 15 2.161 2.108 2.228 18 2.231 2.277 2.319Explain the concept of method validation by describing five importantvalidation facets?
- Discuss the different designs for collecting the information desired in a Randomised Controlled Trial (RCT).The following are words used in animal testing and its alternative methods. Define the following terms - a. Vivisection b. Optogenics c. In vivo d. In vitro cell culture e. In silico computer simulation f. Pharmacokinetics g. Pharmacodynamics h. Tissue culture i. Phototoxicity j. 3D cell cultures10) List down 3 different test animals and give samples for which purposes they can be used in testing of a designed biomaterials? 11) What does FDA abbreviation stand for? 12) Order for the below given steps prior to FDA approval ? Controlled clinical trials In vitro testing (“in glass") In vivo testing w/animal models of disease In vivo testing w/healthy animals
- Describe some sources of potential bias in biomedicalresearch. What are some ways of minimizing such bias?state what the ethical problems are in the case of covid 19 of the challenge testing? List Three reason? what are the problem? How are those terms problems ? What are the problems with them?Define the following terms:• Preclinical Trial• Clinical Trials• FDA Review• Lead discovery• Molecular target-based screening• Phenotypic screening
- What is metrology? How does metrology relate to Analytical Biotechnology? Relate the terms error and uncertainty to the concepts of precision and accuracy. What are the major parameters of instrumental response?• In your own words...how the heck do primers work? What are they actually doing that enable us to use them as a tool in diagnostic science?If you are using sensitivity and specificity to evaluate how well a dichotomous test (like a field sobriety test or home pregnancy test) is working, ideally what do you hope to see? Choose the correct answer and explaing why: a) Low specificity and low sensitivity. b) High specificity and high sensitivity. c) Low specificity and high sensitivity. d)_High specificity and low sensitivity.