Q: 1. Let's suppose there is an organization with two departments with each department requiring 120…
A: Let's suppose there is an organization with two departments with each department requiring 120 host…
Q: Code in Haskell Programming only Space X is planning to start Star link. Programmers at SpaceX are…
A: Coded using Haskell.
Q: What is a foreign key constraint? Why are such constraints important? What is referential…
A: Foreign key A column or columns of information in one table that link to the main key data inside…
Q: Therapy Groups Recreation Groups Socialization Groups Education Groups These groups are gener…
A: Therapy groups: Who is group therapy for?Anyone can participate in group therapy. However, group…
Q: What is Random Forest Classifier?write code to explain it.
A: A Random Forest Classifier is a machine learning algorithm that uses decision trees to predict the…
Q: What are the difference between Kerberos version 4 and version 5?
A: Given To understand the distinction between Kerberos versions 4 and 5.
Q: If you've ever visited Europe (or Canada) you'll know that they tend to measure temperature in…
A: /* PLEASE ALIGN CODE USING SCREENSHOT */ /* PLEASE UPVOTE */ Ans a) def convert(fahrenheit):…
Q: Programming Challenge 1: Create a Java program that collects numeric data from a user (10 values…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: addresses references (provided as decimal numbers). Show all calculations steps. 21112 5500050 1 KR…
A: The answer is
Q: Sketch five User Interface screens for a mobile app for the co-ordination of micro credits between…
A: A mobile user interface (mobile UI) which refers to the graphical and also it is usually the…
Q: Find the square and cube of first n natural numbers.
A: Start Ask user to enter the value of "n" as natural number loop from 1 to the natural number Print…
Q: Briefly explain how libc the malloc() family of functions (malloc(), calloc(), realloc(), free())…
A: We need to discuss how libc the malloc() family of functions (malloc(), calloc(), realloc(), free())…
Q: REMINDERS: PLEASE refer to the starter code in Java. The output MUST match the picture.
A: We need to write a Java code for the given scenario.
Q: Design a detector of prime numbers from 0 to 15. ( Dont consider 1 to be prime) Use canonical sum
A: The solution has been provided in Step 2.
Q: Write a C++ program : Make a class for rectangle which calculates perimeter and area by doing the…
A: answer is
Q: 8. You have a file quotes.txt containing quotes, one per line, on security. Write a function quote()…
A: Solution: Given, We have a file quotes.txt containing quotes, one per line, on security. we…
Q: In this lab, you complete a partially prewritten Java program that uses an array. The program…
A: Uses of Java:- the creation and operation of mobile applications. the creation and expansion of…
Q: C++ Program Subject: Compiler Construction Create a function named Lexical with no arguments. And…
A: ALGORITHM:- 1. Create a enum TokenType and function Lexical. 2. Call it from the main function. 3.…
Q: 7 2 1 2 4 5 4 3 10 -8 4
A: Here From question we are needed to answer the first one.
Q: How can the use of artificial intelligence (robots) affect the work of some people?
A: The above question is solved in step 2 :-
Q: Q. 12 Explain TLS.
A: In this question we need to explain the term Transport layer security (TLS) in networking or cyber…
Q: The primary focus of this assignment is the use of interfaces. In programming, an interface is a…
A: We need to write a java program for the given scenario.
Q: (2.5∗10^4.2)∗(6.2∗10^6.1)/4.4∗10^1.4
A: The rule to follow for operations is EMDAS where E is exponentiation ^ M is multiplication * D is…
Q: Complete the checkCharacter() method which has 2 parameters: A String, and a specified index (int).…
A: Editable source code: // creating class named LabProgram public class LabProgram { //…
Q: Implement the classes that are given in the class diagram. Also implement a TestVehicle class where…
A: We need to define the classes :
Q: Please convert this C++ code to Java code. REMINDER: The output MUST match the picture.
A: Updated program in Java language.
Q: 11. Write a function called intersect() that takes 2 parameters, both lists. It then prints, one per…
A: In the below python program AND operator is used to find the common elements between 2 lists. Given…
Q: C:/Users/r1821655/CLionProjects/untitled/sequence.cpp:48:5: error: return type specification for…
A: Constructor is a special method that is invoked automatically at the time of object creation. It is…
Q: 2. Geraldine's Landscaping Service and Gerard's Lawn Maintenance are merging their businesses and…
A: These question answer is as follows
Q: How to do the kSum in O(1), i only can do it like public long ksum(int k) { long sum = 0; for(int…
A: Here I have written a python code that takes input from the user and asks the user how many elements…
Q: For the given parameters 'P' = 3 and 'Q' = 19 find the value of 'e' and 'd' using RSA algorithm and…
A: The steps include in the RSA algorithm Choose two large primes p, q Compute n=p*q, ϕ(n)=(p-1)*(q-1)…
Q: What is a camera shutter speed, and what creative things can you do with it? Controls Exposure…
A: Camera Shutter speed is the speed at which the shutter of the camera closes.
Q: Total = a + b + c; Average = Total A. B. C. D. / 6; Logic Errors Run-time Errors None of the above…
A: The above question is solved in step 2 :-
Q: Select which network to which each IP address is a part of, either Network A or Network B. Network…
A: For Network A - Number of IP address assignable is found by subtracting 24 from 32 which is 232-24 =…
Q: Create a program that asks a user to input the year they were born and will give them a fortune…
A: HI THEREI AM ADDING PYTHON CODE AS PER REQUIREMENT BELOWPLEASE GO THROUGH IT THANK YOU
Q: Q.13 What is authentication? Explain various methods for authentication.
A: There are many methods of authentication, including passwords, biometrics, and security questions.
Q: Write a code to print a string in a matrix form so that it forms a "plus" in matrix and other…
A: ALGORITHM:- 1. Declare and initialise the string. 2. Place the string in matrix form in plus form.…
Q: I am attempting to write a 2-paramter constructor that meets the following specifications: /** *…
A: A constructor is a unique method that is used to initialize objects. The constructor is called…
Q: 6.9(10^6.2)/ (3.7∗10^0)∗(1.7∗10^ 2.1)
A: Operators precedence: 1 () Brackets 2 ++ -- ^ unary operators, power 3 * / %…
Q: C. Draw a circle 25 pixels in diameter that moves with the mouse. When the program is first run, the…
A: Dear student, Here is your step-by-step solution --->
Q: Explain the whole process of how a neural network learns in extracting/finding patterns in large…
A: The whole process of how a neural network learns in extracting/finding patterns in large sets of…
Q: Q.13 What is authentication? Explain various methods for authentication.
A: Introduction In this question, we are asked about Authentication and its various method
Q: Create a personal page (you may use a bogus information) - Include information needed for a personal…
A: Program Approach: Step 1: Start with <!DOCTYPE html> followed by opening the html tag. Step…
Q: 2. With the growth of internet service providers, a researcher decides to examine whether there is a…
A: Dear student, the answer is provided below.
Q: a) Assuming a 1 KB page size, what are the page numbers and offsets for the following logical…
A: Given: 1 KB page size Find for 21112 & 5500050 process size 66800 calculate internal…
Q: Write a GO grammar expression where: 1. An expression is either an id (you may assume this token…
A: Answer 1 S -> id | S ^ S | S $ S | S ^ S $ S | S $ S ^ S In which S is a character string Assume…
Q: Each time slot contains 148 bits. Just 114 of these 148 bits reflect speech or other info. of…
A: The answer is
Q: SSN name age address phone Pharmacy Start date Patient End date supervisor sname m address m m n…
A: ER diagram: A particular sort of flowchart that shows how "entities" like people, things, or…
Q: Q5) Given the DFA below describe in English the set of strings accepted by it. 0 0 0 (2) 0.1
A: Given DFA: To find: Set of accepted string by given DFA
Q: In GSM, a "TDMA frame" is composed of eight distinct time slots. Each GSM time slot is 577 s…
A: TDMA frame in GSM: A TDMA frame is defined by the GSM standard as a combination 8-time slot.…
python help....
list lst of scores of 15 deliverables:
[94, 86, 85, 81, 86, 96, 91, 85, 86, 83, 89, 81, 86, 98, 84]
a. What are the lowest, highest, and average score?
b. What is the median score?
c. What is the range of the scores?
d. How many of the scores are 85?
Step by step
Solved in 4 steps with 2 images
- PYTHON QUESTION : The Syracuse sequence of an integer N is the sequence of integers starting with the term N, where each following term is half of the preceding term if it is even, and one plus three times the preceding term if it is odd. The sequence ends when it reaches the integer 1. The maximum of the Syracuse sequence of an integer N is the highest number reached by this sequence. This maximum can sometimes be very high compared to the starting integer N. What is the maximum of the Syracuse sequence of 3428767? To answer this question it is useful to modify the code given in demonstration which calculates the Syracuse sequence. The code given in the demo : n = 27 print(n) while n != 1: if n%2 == 0: n = n // 2 # where n //= 2 or n >>= 1 else: n = 1 + 3*n print(n)AIM: TO SWAP 2 NUMBERS WITHOUT USE OF TEMPORARY VARIABLE THEORY: C is a general-purpose, middle level, procedural computer programming language supporting structured programming, lexical variable scope, and recursion, with a static type system. C is an imperative procedural language. Let a and b be variables in which integral values are being inserted . tw numbers can be swapped without using a temporary variable by using arithmetic operations. Another alternative method is by use of logical operators. ALGORITHM: STEP 1: Start STEP 2:Print "Enter two numbers'" STEP 3: Input x,y STEP 4:Print “ Numbers x,y before swapping STEP 5: x x+y STEP 6: y<– x-y STEP 7: x x-y STEP 8: Print “ Numbers x,y after swapping " STEP 9: StopPython only* Use recursive function*. Define concentricCircles with 4 parameters Use def to define concentricCircles with 4 parameters here is the specification for concentricCircles function: It draws a series of concentric circles, where the first parameter specifies the radius of the outermost circle, and the second parameter specifies the number of circles to draw. When viewed as nested rings, all rings should have the same thickness. The third and fourth parameters specify an outer color and an other color, respectively. The outer color is used for the outermost circle, and then every other circle in to the center alternates between that color and the other color. We will test both how many circles are drawn as well as whether the correct circles are drawn in the correct order. Hint: Each function call frame only needs to draw a single circle. Note that you must use the turtleBeads drawDot function to draw each circle Do not use any kind of loop Within the definition of…
- Python only* Use recursive function*. Define concentricCircles with 4 parameters Use def to define concentricCircles with 4 parameters here is the specification for concentricCircles function: It draws a series of concentric circles, where the first parameter specifies the radius of the outermost circle, and the second parameter specifies the number of circles to draw. When viewed as nested rings, all rings should have the same thickness. The third and fourth parameters specify an outer color and an other color, respectively. The outer color is used for the outermost circle, and then every other circle in to the center alternates between that color and the other color. We will test both how many circles are drawn as well as whether the correct circles are drawn in the correct order. Hint: Each function call frame only needs to draw a single circle. Note that you must use the turtleBeads drawDot function to draw each circle Do not use any kind of loop Within the definition of…DO NOT USE EXISTING ANSWERS ON CHEGG OR COURSE HERO OR ANY OTHER SERVICES PLEASE! Thanks :) CODE IN PYTHON AND SHOW COMMENTS TO EXPLAIN CODE A confused Dutchman trying to speak English could say “I am in the war”, even though there is no hostile activity going on. The confusion1 here is that the English sentence “I am confused” is translated in Dutch as “Ik ben in de war”, which is phonetically (“sounding”) quite close to the first sentence. Such confusion leads to much enjoyment, but can complicate matters a bit. Given a sentence in Dutch and a dictionary containing both correct translations as well as phonetic (incorrect) translations of individual words, find the translation of the sentence and indicate whether it is correct, or in case there is more than one find the total number of correct and incorrect translations. A sentence is correctly translated when each word of the sentence is correctly translated. Input The input consists of: One line with an integer n (1≤n≤20), the…The number of bacteria measured at different times t is given in the following table. By Python code, determine a function that best fits the data (built-in function allowed). Use the equation to estimate the number of bacteria after 3.5h (built-in function not allowed). Make a plot of the points and the equation.
- please code in python """ TODOReturn whether the pattern was found or not (found), the number of times the pattern was found (n), all starting positions at which the pattern was found (positions) and the number of comparisons.""" Given text: CAGTCAGTCATCATGCGTATCAGCTGATC TATCGGGCGCGCGCGTATCATC Combinations to look for: TGCGTATCAGCTCGCGCG TATGTCAIdentify the standard form of the following argument. p → q q → r ... p → rIt is required to implement a MATLAB program By using "user define function" that used to: • Read (100) diagnosis data shown in the table below from the key board. • Display all Patient's data who have a "High Risk "condition only "High Risk" are patient who have an age greater than or equal to 75 If there are no high risk patients the program should terminated with an appropriate message Diagnosis Data Sample No. Patient ID Name Ag Height (cm) Weight(kg) e 1 905792 K.M. Liam 50 166 90 126987 A.H. Noah 60 170 105 100 913376 L.S.Benjami 80 160 85
- Halloween is a celebration observed in a number of countries on 31 October, the eve of the Western Christian feast of All Hallows' Day. Halloween activities include trick-or-treating, attending Halloween costume parties, carving pumpkins into jack-o’-lanterns, lighting bonfires, apple bobbing, divination games, playing pranks, visiting haunted attractions, telling scary stories, and watching horror films. [Source: Wikipedia] Suppose the goal is to estimate the parameter stated in question 3 using a 99% confidence interval with margin of error no larger than 0.062. What is the minimum number of trick-or-treaters that would need to be selected to allow the calculation of a 99% confidence interval with margin of error no larger than 0.062? It can be assumed for this problem only that the proportion of all people who went trick-or-treating who received fruit in addition to candy is 0.16 and this number can be used for this problem. Which of the following is the correct answer answer?…Here is a Python function. def do_something(lst1, lst2): for element1 in lst1: for element2 in lst2: if element1 >= element2: return False return True What is the overall purpose of this function? a) Return True iff the length of lst2 is less than the length of lst1.b) Return True iff each element in lst1 is less than the element at the same index in lst2.c) Return True iff every element in lst1 is less than every element in lst2.d) Return True iff every element in lst1 is less than the first element in lst2.e) Return True iff every element in lst2 is less than the first element in lst1.please code in pythonthis is the continuation of the above questionHow would we solve tidef tons_inside(deposits, top, bottom, left, right): """Returns the total number of tons of deposits for which the row is at least top, but strictly less than bottom, and the column is at least left, but strictly less than right.""" # Do not alter the function header. # Just fill in the code so it returns the correct number of tons. pass # delete this statement before entering your code!