Q: Define the following terms: (a) papilla (b) abscission layer. How are each of thse structures invol...
A: Papilla These are complex structure that are formed between the plasma membrane and the inside of t...
Q: Why is homeostasis a characteristic of life?
A: Homeostasis regulates the normal activities of the body by managing optimal circumstances for enzyme...
Q: Explain the Advantages and Disadvantages of Asexual Reproduction.
A: It is atype of reproduction involving a single organism without fusion of gamete which usually occur...
Q: Describe the components of a nucleotide. Name some nucleic acids and nucleotides, and discuss the im...
A: A nucleotide is a molecule which is attached to a nitrogen containing base and a phosphate group. It...
Q: Which best describes the fate of this protein?
A: The correct answer to this question is: The protein remains in the cytosol
Q: Differences between monohybrid, dihybrid and modified ratios
A: Introduction: A cross is the result of the mating of two parents with different genes, resulting in...
Q: Briefly site the environmental factor by using the followings in plant design with suitable example,...
A: A answer.. In plant for the overcome of toxicity of byproduct.. Always going through byproduct post ...
Q: Using the workflow images and data table match. the results of each te Not determined by the MacConk...
A: Staphylococcus aureus is a gram-positive bacterium that causes a number of clinical conditions. This...
Q: Males of certain Australian beetles have been seen trying to copulate with everything from beer bott...
A: The term "animal behaviour" refers to everything animals do, including movement and other actions, a...
Q: Give an example of each of the following evolutionary forces: mutation, natural selection, genetic d...
A: Mutation:change in structure of gene,that result in variant form. Ex: Genetic mutation of fruit fl...
Q: Contrast acids and bases, and discuss their properties.
A: The whole of the living and non living world are made of various elements. These are metallic or non...
Q: Describe why this position in your protein is important and outline the effects the mutation will ha...
A: Any change in DNA is referred to as a mutation. Any heritable and genetic modification in the genome...
Q: Place the following events in a chemical synapse between two neurons in the correct order.
A: Answer: Chemical synapse between two neurons in the correct order is- 1. arrival of nerve impulse ...
Q: Which of the following descriptions or features does/do NOT apply to Phylum Nematoda? a. Chitinou...
A: Introduction Roundworms are organisms that belong to the phylum Nematoda. Nematodes in the soil eat...
Q: Draw what you would expect to see for acid fast stain and endospore stain procedure if you did not s...
A: only acid fast appears red/pink. Only endospore appears green. Vegetative cell become colourless.
Q: Why is a needle sometimes inserted into the pleural cavity to remove air and possibly fluid in patie...
A: Needle aspiration is a kind of biopsy procedure In fine needle aspiration, a thin needle is inserte...
Q: Why is it important to know the isotonic point of human cells when administering an IV? Explain what...
A: Isotonic solutions are IV fluids that have a similar concentration of dissolved particles as blood. ...
Q: Explain why oil does not dissolve in water ?
A: Introduction Water is a gaseous, liquid, or solid material that is made up of the chemical elements...
Q: Draw a haploid mitosis of the genotype a+ ; b.
A: Mitosis and meiosis are two kinds of cell division in which chromosomes are segregated into daughter...
Q: what are the difference of classical breeding and recombinant dna technology
A: Classical Breeding: Classical breeding, which entails selectively breeding the best-performing plan...
Q: QUESTION 6 Examples of noncoding RNA are messenger RNA and ribosomal RNA. O True O False
A: Genes are heredity units exhibited on the chromosome that carry hereditary information . DNA is two ...
Q: What are the frequency and percentage distribution of amino acids in the polypeptides coded by the O...
A: Introduction When a DNA gene is disrupted or damaged in such a way that the genetic message carried ...
Q: Define mucous membrane
A: A biological membrane, also known as a biomembrane or a cell membrane, is a permeable membrane that ...
Q: If a viral cell penetrates ahealthy rabbit, the cell will divide into two in about one day. After a ...
A: A virus is a genetically modified organic particle that infiltrates living cells and utilises the me...
Q: Opponents of the widespread use of synthetic pesticides contend that the harmful effects often outwe...
A: Monoculture is the farming practice in which the same crops are grown in the same field every year d...
Q: Which molecules diffuse the easiest across the plasma membrane without the aid of a transporter/chan...
A: The plasma membrane of the cell is the controlling element that regulate the movement of different m...
Q: Klaneys Skin All tissues receive more blood during exercise
A: Exercise increases the blood pressure and the blood flow nearly to all the organs inside the body. B...
Q: What outcome is predicted for a double mutant cell with an activating mutation in PK2 and an inactiv...
A: PK1 and PK2 act sequentially intracellular in a signalling pathway.Pk2 activates the PK1 because it ...
Q: Question 17 Which of the following are true regarding proteins? Select all that apply. O the amino g...
A: 2,3,6. Mild increase in temperature usually increases or maybe doubles the function of enzymes but o...
Q: In mice, dwarfism is caused by an X-linked recessive allele, and pink coat is caused by an autosomal...
A: According to the given question, In mice, dwarfism is caused by an X-linked recessive allele, and pi...
Q: Tilogell gas ng hitrate to nitrite 15. Denitrifying bacteria need which of the following conditions ...
A: Note Introduction: Denitrification is a microbially mediated process that reduces nitrate (NO-3) to ...
Q: Question 1 Why is light an important factor in forest ecosystems? Choose all that apply. Main supply...
A: Biological rhythm is our body's response to light and dark periods and it is controlled by the inter...
Q: Define gel electrophoresis?
A: All living things require DNA. It plays a role in heredity, protein-coding, and the genetic instruct...
Q: In Figure 3-17, in which bar of the histogram would the genotype R1/r1 • R2 /R2 • r3/r3 be found?(pi...
A: Answer- R1/r1 • R2/R2 • r3/r3 is found in 2nd bar of the histogram with number of contributing polyg...
Q: C. Give the meanings of the followiìng abbreviations 1. TPN - 2. PUD - 3. EGD - 4. IBD - 5. BE - BRB...
A: Medical terminology is a vocabulary that is used to explain human body in detail, covering all of it...
Q: What are the two parts used to carry the microscope? What does Total Magnification mean?
A: Microscope is used in laboratory settings to obtain a clear and precise view of the specimens under ...
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA...
Q: Choose one 'group' results (for example you may choose group 4 from cross 2), complete the Chi-squar...
A: Chi-square analysis is a simple test to determine if a hypothesis is true by quantifying the deriv...
Q: In histopathology, provide 5 advantages of a properly fixated tissue.
A: 1.) tissue fixation is to preserve cells and tissue components in a “life-like state” or as little a...
Q: picture. 36 USF Reprinted with permission from Popular Science magazine, ©2000, Times Mirror Magazin...
A: The statement used by Chew Chew is " we stole the idea of eating food from the biological world, bu...
Q: What are the frequency and percentage distribution of amino acids in the polypeptides coded by the O...
A: The frequency and percentage distribution of amino acids in the polypeptides coded by the Original D...
Q: A- Explain of the folowing: 1- Cytokinesis 2- Bacteriophages 3- MTOCS 4- protein turnover
A: Cell cycle is a series of events that take place when a cell grows. Cell cycle comprises of nuclear ...
Q: 1. Which of the scientific method steps best exemplifies the use of inductive reasoning? a. observat...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: What surprised you about the internal anatomy of the pig?
A: Introduction: Pork is the meat that comes from pigs. It is one of the most widely consumed meats in ...
Q: Match the following structures of a typical synovial joint with the correct letter. Letters may be u...
A: A - periosteum B - location of synovial fluid ,joint cavity C - articular cartilage
Q: Part 2: What's in My Food? Consider a meal of pancakes with syrup and a side of bacon. Answer the fo...
A:
Q: Q. Explain The following 1- Scientific importance of the studying of geology? 2- Explain the aim of ...
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby guidelin...
Q: Define about DNA Transposons ?
A: Introduction :- DNA is a substance found inside cells that carries genetic information and passes it...
Q: B- Remember the main function of the following for 3 only: 1- Checkpoint during cell division 2- Nuc...
A: Cell division It is defined as the process of the multiplication of cells. It involves both nuclear ...
Q: Assume independent assortment and start with a plantthat is dihybrid A/a ; B/b:a. What phenotypic ra...
A: The father of modern genetics is Gregor Mendel. He was a naturalist who gave a new view to the conce...
unsure what A and D are pointing to on vein 100x
Step by step
Solved in 2 steps