A particular transposable element generates flanking direct repeats that are 4 bp long. Give the sequence that will be found on both sides of the transposable element if this transposable element inserts at the position indicated on each of the following sequences. a. Transposable element, a. 5'-ATTCGAACTGACCGATCA-3' b. b. Transposable element 5'-ATTCGAACTGACCGATCA-3'
Q: The human hexokinase enzyme has the same function as the bacterial hexokinase enzyme but is somewhat…
A: Promoters are upstream regions of a gene that are used to initiate and control gene expression. The…
Q: Certain repeated sequences in eukaryotes are flanked by short direct repeats, suggesting that they…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Introns in eukaryotic protein-coding genes are rarely shorter than 65 nucleotides in length. What…
A: In eukaryotes the template strand of DNA gets transcribed into pre-mRNA by the process known as…
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: The functions of DNA and RNA are controlled by genes. Genes are made up of a distinct collection of…
Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…
A: Mutations are the changes in the DNA sequence, the base sequence of the DNA changes. Mutations can…
Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…
A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…
Q: Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will…
A:
Q: You are working with a laboratory strain of E.coli that contains a 10 base-pair deletion in the Lac…
A: Introduction of the concept: The given concept is based on the lac operon in E.coli. The operon…
Q: If there are multiple start condo, how can you identify the real start codon? By observing Okazaki…
A: Transcription and translation are specialized events that are part of the central dogma i.e. DNA to…
Q: Ochre and amber are two distinct nonsense mutations. Before the genetic code was worked out, Sydney…
A: Gene expression is a process by which genetic information from a gene is used for the production of…
Q: Nonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient…
A: Ans... a base substitution in an enhancer region
Q: a. What sequence information about a gene is lackingin a cDNA library?b. Can clones in a cDNA…
A: The cDNA or complementary DNA is derived from mRNA which is transcribed from genomic DNA (gDNA). It…
Q: a. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation…
A: ρ-dependent is basically a translation termination mechanism occuring in prokaryotic cells. Here ρ…
Q: Many eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT…
A: The CAAT box is popularly known as a core promoter or basal promoter or simply the Promoter. It is…
Q: Codon optimization is a widely used process for recombinant expression in prokaryotic systems.…
A: The codon is comprised of three nucleotides or triplets of bases. A nucleotide refers to a molecule…
Q: Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by UAC and…
A: Given Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by…
Q: After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into…
A: a) By preparing a probe using the actin amino acid sequence or using the actin gene sequence known…
Q: Suppose that the string of A nucleotides following the inverted repeat in a rho-independent…
A: Rho-factor is a type of protein, which causes the termination of the transcription process in…
Q: With several molecular biology techniques, researchers identified that the intertwined sequence…
A: Cell division is regulated by a network of genes and proteins through cell cycle checkpoints.…
Q: A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity…
A: In bacteria, two transcription termination mechanisms take place. Intrinsic termination, which is…
Q: Why are cDNA libraries desirable for the expression of eukaryotic genes in prokaryotes?
A: In cDNA library ("c" in cDNA stands for "complementary"). It is a series of cloned diagnostic DNA…
Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. Using the…
A: Genetic codes are stored in the form of trinucleotide sequences (codons) in the mRNA.The mRNA gets…
Q: Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it…
A: Introduction:Gene is a region of DNA that encodes for proteins. DNA is transcribed into mRNA which…
Q: Let’s suppose that a vertebrate organism carries a mutation that causes some cells that normally…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: To identify the following types of genetic occurrences, would acomputer program use sequence…
A: Introduction With the advancements of Bioinformatics tools and sequencing techniques we can easily…
Q: A nonsense mutation (a) causes one amino acid to be substituted for another in a polypeptide chain…
A: A nonsense mutation is defined as the process of the substitution of only a single base pair. This…
Q: How do eukaryotic and prokaryotic RNA polymerases compare? a. Since eukaryotic RNA polymerases are…
A: Transcription in prokaryotes and eukaryotes is different in many aspects. Eukaryotic transcription…
Q: . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…
A: In molecular biology, a point mutation in DNA occurs when a single (two ring) purine (A or G) is…
Q: Lysine 4 of histone H3 (H3K4) is methylated in thenucleosomes of many transcriptionally active…
A: The nuclear genomes of eukaryotes are composed of histones and nonhistone proteins. Histone proteins…
Q: Which sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c)…
A: Promoter It is a DNA sequence that controls whether a gene is turned on or off. The promoter…
Q: Histone deacetylase (HDAC) enzymes a.Promote initiation of translation. b.Complex with…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: A graduate student studying the pathogenic bacteria Acinetobacter baumannii made cDNA from…
A: Biotechnology is the use of our understanding of biological processes to develop useful applications…
Q: Describe the function of telomere repeat-binding factors.
A: Telomeres are the ends of chromosomes. they are made up of short repetitive sequences and prevent…
Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…
A: Introduction Termination of transcription: It involves the termination of RNA chain synthesis by…
Q: Albinism is a condition where individuals can't make melanin pigment. The affected gene encodes for…
A: Albinism is a group of inherited disorders which can lead to no production of melanin pigment due to…
Q: Using ClustalOmega (available here), compare the nucleotide sequence of the regulatory region for…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by errors…
Q: Retrotransposons are a class of mobile elements that transpose via an RNA intermediate. Contrast the…
A: On the basis of their manner of mobilization, DNA transposons have the ability to move by making…
Q: This problem investigates issues encountered in sequencing the inserts in cDNA libraries.a. If you…
A: In genetics, complementary DNA (cDNA) is DNA synthesized from a single-stranded messenger RNA (mRNA)…
Q: You isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the…
A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around each other to form a…
Q: What factor might potentially determine the length of the flanking direct repeats that are produced…
A: Flanking or terminal repeats are the sequences DNA that are repeated on the both ends of a sequence…
Q: a)How far along the DNA would the transcription "bubble" formed by RNA polymerase move in 10…
A:
Q: Will restriction sites for an enzyme that has 4 bp in its recognition sequence be closer together,…
A: A restriction site is a DNA sequence that binds to a given restriction enzyme
Q: Are there any distinctive features associated with TEs Transposable Elements? What are these?
A: Transposable elements have shaped the genome during evolution, allowing for the development of new…
Q: After Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into…
A: Cloning is a particular technique scientists use to make exact genetic copies of living organisms.…
Q: Based on this alignment, you can identify areas of the protein sequences that are key regions of the…
A: Multiple sequence alignment is used to obtain optimal matching between three or more sequences of…
Q: Long Adenine and Thymine stretches are also to be avoided as these will “breath” and open up…
A: Introduction DNA acts as a genetic material in our body which passes from one generation to…
Q: Computer programmers, working with molecular geneticists, have developed programs that can identify…
A: Transcription is the process by which the information in a strand of deoxyribonucleic acid (DNA) is…
Q: A novel, RNA-containing splicing factor is purified on the basis of its physical interaction with a…
A: Splicing is the process by which the non-coding regions (introns) are excised from the newly…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- The hunchback gene contains a 5′ transcriptional regulatory region, a 5′ UTR, a structural region (the coding sequences), and a 3′ UTR.a. What important sequences required to controlhunchback gene expression are found in the transcriptional regulatory region of hunchback?b. What sequence elements that encode specific protein domains are found in the structural region ofhunchback?c. Another important kind of sequence is located inthe 3′ UTR of the hunchback mRNA. What mightthis sequence do?A particular transposable element generates flanking direct repeats that are 4 bp long. Give the sequence that will be found on both sides of the transposable element if this transposable element inserts at the position indicated on each of the following sequences.Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
- What is the primary difference betwee class I and class II aminoacyl-tRNA synthetases. a. Class I synthetases acylate the terminal 2’ hydroxyl group of tRNAs; Class II synthetases acylate the terminal 3’ hydroxyl group of tRNAs. b. Class I synthetases acylate the terminal 3’ hydroxyl group of tRNAs; Class II synthetases acylate the terminal 2’ hydroxyl group of tRNAs. c. Class I synthetases acylate tRNAs with hydrophobic amino acids; Class II synthetases acylate tRNAs with polar amino acids. d. Class I synthetases acylate tRNAs with polar amino acids; Class II synthetases acylate tRNAs with hydrophobic amino acids.Remembering that the wobble base of the tRNA is the5′ base of the anticodon:a. In human tRNAs, what are the sequences of allpossible anticodons that were originally transcribedwith A in the wobble position? (Assume this A isalways modified to I.)b. In human tRNAs, what are the sequences of allpossible anticodons that were originally transcribedwith U in the wobble position? (Note: Any singletype of tRNA with a U at the wobble position canbe modified only in a single way.)c. How might the wobble Us in each of the anticodonsin (b) be modified and still be consistent with thegenetic code?d. What is the theoretical minimal number ofdifferent tRNA genes that must exist in thehuman genome? (Assume that xo5U pairs with A,G, or U only.)Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited diseases. Certain types of TNREsproduce a long stretch of the amino acid glutamine within theencoded protein. When a TNRE exerts its detrimental effect byproducing a glutamine stretch, are the following statements true orfalse?A. The TNRE is within the coding sequence of the gene.B. The TNRE prevents RNA polymerase from transcribing thegene properly.C. The trinucleotide sequence is CAG.D. The trinucleotide sequence is CCG.
- At least one nonsense suppressing tRNA is knownthat can suppress more than one type of nonsensecodon.a. What is the anticodon of such a suppressing tRNA?b. What stop codons would it suppress?c. Could this tRNA possibly also function as a missense suppressor?d. What are the amino acids most likely to be carriedby this suppressing tRNA?You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wild-type composition...lys-ser-pro-ser-leu-asn-ala-ala-lys....to the lys-val-his-his-leu-met-ala-ala-lys. a. Decipher the segment of MRNA for both the original protein and the double mutant. mutant form b. Which base was added? Which was deleted?
- The chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a transcription factor binding site. (1). Evaluate a sequence “GACATTCA” to find out which segment of the sequence fits the binding site best. (2) What is the max score that a sequence can have with this PSSM? (3) What is the minimum score a sequence can have with this PSSM?Consider the mechanism of the enzyme RNase: What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain. What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.MCAD deficiency is an inborn error of metabolism. The coding strand is shown for the wild-type gene. The TATA box and kozak sequences are shown in parenthesis. Wild-type: 5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ What is the resulting polypeptide from the wild-type protein?