A peptidyl-tRNA in the P site has a strange modification with an ether versus an ester bond to thetRNA. When it is in the P site undergoing catalysis in the otherwise normal way, this molecule willbecome:More susceptible to the nucleophilic attackA better nucleophileO Less susceptible to the nucleophilic attackA worse nucleophile

Answer :- The scenario with peptidyl-tRNA in the P site—a part of the ribosome involved in protein…

Answered: A peptidyl-tRNA in the P site has a…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 21P

See similar textbooks

Similar questions

Which of the following would be a good chemotherapy approach: blocking formationof the ribonucleotide GTP or blocking formation of the deoxyribonucleotide dGTP?Why? Please explain the chemical differences between each of the two nucleotides. Use the specific processes below to support your choice by explaining how either GTP or dGTPare related to these and how loss of the particular molecule would affect each process. *PEP carboxykinase in gluconeogenesis*Succinyl-CoA synthetase in the TCA Cycle*Glucagon signal transduction
Match the following antibiotics with the drug strategy that would provide resistance to them. rifampin which blocks transcription [ Choose ] Choose] tetracycline which misaligns the beta-lactamase anticodon to its codon mutation of the TRNA binding site of the ribosome penicillin which blocks peptidoglycan creation of alternate metabolic pathway that ultimately leads to the same product synthesis mutation of RNA polymerase polymyxin which causes leakage in the porin which removes drug from periplasmic space cell membrane sulfonamide which inhibits enzyme of [Choose ] folic acid synthesis pathway Question 14 2 pts % & 5 7
Which statement is true for the active site residues of RNase A, lysozyme, or trypsin? Select any/all answers that apply. O A. His12 (RNase A) initially acts as an acid. O B. His119 (RNase A) initially acts as an acid. O C. Glu35 (lysozyme) initially acts as an acid. O D. His57 (trypsin) initially acts as an acid. O E. Ser195 (trypsin) initially acts as an acid.
Given the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro in
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
After the polypeptide chain is passed to the next amino acid the uncharged tRNA leaves through this site A site E site P site
The synthesis of a protein requires that the amino acids that constitute the growing polypeptide chain be covalently linked to the amino acid attached to the tRNA at the aminoacyl site of the ribosome. Which of the following catalyses this reaction? Options: the aminoacyl tRNA synthetase eEF2 eEF1-GTP a large ribosomal RNA the initiator tRNA met
Using threonyl-tRNA synthetase as an example, account for the specificity of threonyl-tRNA formation.
Which of the following cannot be said regarding aminoacyl tRNA synthetase? It is essential for the correct reading of codons. A single tRNA synthetase can attach different amino acids to their corresponding tRNA. It is first activated when it catalyzes a reaction between ATP and an amino acid to form an aminoacyladenylic acid (amino acyl-AMP). It is responsible for the attachment of the correct amino acid to the correct tRNA. There is a different tRNA synthetase for each amino acid that will be attached to a tRNA.
Why do aminoacyl-tRNA synthetases need ATP? to prevent the 2'OH from being aminoacylated to provide energy to drive the reaction to add the 3' adenosine onto the tRNA to add a leaving group on the amino acid
E. coli ribonuclease H1 is an enzyme that catalyzes the hydrolysis of phosphodiester bonds in RNA. Its proposed mechanism involves a 'carboxylate relay,' as shown below. His124 Asp70 || -HN-CH-C -HN-CH-C- CH2 CH2 c=0 RNA substrate HN H. H. (1) Fill the blanks. In the reaction scheme above, His124 acts as a ( ). The purpose of this relay system is to deprotonate the water molecule (II) so that it becomes a better ( :0
TRNAS are 'charged' or activated by aminoacyl TRNA synthetases. Select the correct statements regarding this process. The process is dependent on interactions between ribosomes and aminoacyl TRNA synthetases. The aminoacid is added to the D-loop of the tRNA. Aminoacyl TRNA synthetases are pre-associated with tRNAS. The amino acid is attached to the terminal to the 3' hydroxyl of an adenine in the acceptor arm. The process requires an aminoacyl-adenylate intermadiate. QUESTION 19 Select the correct statements regarding myosin-mediated contraction the sarcomere. O Ca2+ is required for the binding of myosin to f-actin. Myosin and f-actin are randomly distributed in the sarcomere. Physical pulling of the actin microfilament requires three distinct conformation changes on myosin that involve ATP binding, ATP hydrolysis and sequential release of inorganic phosphate and ADP. Myosin-mediated contracted is ubiquitous across all cell types. O O O O

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS