After Eating a pizza Tomatoes and Pizza Dough =Producers – 10,000 or 20,000 Cheese – Primary Consumers = Level 2 -1,000 Pepperoni and Saugage – Level 3 (Pigs and Cows) 100 Me (Tertiary Consumer) 10 Using Trophic Level Diagram below Calculate the total energy consumption once you are done eating this meal.
Q: The structure of enzymes that just includes folding and is caused by hydrogen bonding only is called…
A: Introduction The three-dimensional arrangement of atoms in an amino acid-chain molecule is known as…
Q: ***Express your opinion on the idea: The possibility of a single locus in a DNA to code for…
A: Ya this is possible, if a single locus can produce multiple mRNA sequences after splicing, depending…
Q: 1. THE MALE GAMETES ARE PRODUCED IN THE?? A. TUBULES B. TESTES C. EPITHELIAL D. PENIS 2. PLANT WAS…
A: Spermatogenesis gives rise to the production of male gametes.
Q: To examine: Whether the statement, “The three respiratory enzyme complexes in the mitochondrial…
A: The mitochondria is a double-membraned structure found in both plant and animal cells. The structure…
Q: Recommendations for a healthy diet suggest which of the following energy distributions? A.…
A: Introduction Carbohydrates, lipids, and proteins are macronutrients that must be consumed in large…
Q: List two types of multifactorial inheritances and explain them.
A:
Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…
A: Polythiocarbamide ( PTC ) is bitter chemical compound . Sone individual able to taste it while other…
Q: 1. Name the structure labeled A (there are several in this image). 2. Name the specific tissue that…
A: The diagram shows the layers found in skin. The skin is the largest organ in the body. There are…
Q: Write the characteristics of the seven taxonomic hierarchy in sentences/ paragraph and their…
A: Please follow step 2 for detailed explanation.
Q: The bond is found in protein and linked the amino acid is
A:
Q: Reproduction that involves two parents is called. Asexual reproduction Behaviour Genetics Sexual…
A: Biology is the study of life or living matter in all of its forms and manifestations, with a focus…
Q: To examine: Whether the statement, “The number of c subunits in the rotor ring of ATP synthase…
A: ATP, or adenosine triphosphate, is an organic molecule that provides energy during various metabolic…
Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…
A: For living functions, that is when it comes on to the term that the cell eukaryotic cells require a…
Q: To examine: Whether the statement "protein tyrosine phosphatases display exquisite specificity for…
A: Protein phosphatases (PPs) regulate a wide range of signalling systems in plants, and their blockage…
Q: Please you explain why the answer is true or false for this question.
A: In biology, evolution is the process of a species' features changing over numerous generations by…
Q: GENERAL EXCHANGE VENTILATION (MORE AIR ENTERS THAN IS REMOVED) IS NEEDED FOR GENERAL EXCHANGE OF…
A: Exaust Ventilation is used for 4). Preventing propagation of pollutants throughout the room.
Q: To examine: Whether the statement, “The number of c subunits in the rotor ring of ATP synthase…
A: ATP, or adenosine triphosphate, is an organic molecule that provides energy during various metabolic…
Q: A community-based intervention program for hypertension was undertaken in two communities to compare…
A: Given: Hypertension is a prominent risk factor that poses global burden of diseases. It is most…
Q: Assume for a moment that crossing-over did not occur. Would you agree that you received half of your…
A: Crossing over is a phenomenon that develops in novel gene combinations by transferring and swapping…
Q: Can you explain the answer and how to find it ? Number 1
A: Any Change in the genetic material, which is not caused by recombination, tnat leads to altered…
Q: What is the advantage of the countercurrent gas exchange in the case of some molluscs? Why is it not…
A: Counter current involves blood in the capillaries flowing in the opposite direction to the flow of…
Q: A patient is admitted to the surgery ward for an appendectomy. Describe the layers of muscles the…
A:
Q: In contrast to our jaws. which move up and down, the mouthparts of arthropods move side to side.…
A:
Q: Explain what happens to the population when birth rate is greater than death rate, death rate is…
A: The birth rate is the total number of live births per 1000 individuals divided by the duration of…
Q: 1. A package of nuts contains 3 servings, and each serving contains 150 calories. If you eat the…
A: A calorie is a unit of energy. It refers to the energy people get from food and drink they consume.
Q: 1. Account for the success of parasitic flatworms. Cite specific strategies to support your answer.…
A: Please follow step 2 for detailed explanation.
Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…
A: There are different kind of interactions occurs in diverse organisms in the environment;which affet…
Q: explain why the invention of solid culture media was of great importance to the development of…
A: Most microbiological tests rely on culture media to obtain pure cultures, grow and count microbes,…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: What is the genetic phenomenon when a person has a specific genotype but phenotypically presents…
A: Genotype is defined as the genetic constituent of an organism. where is the phenotype is defined as…
Q: MECHANISMS EXAMPLES 1. 1. Geographical Isolation 3. 1. 2. 2. Temporal/Seasonal Isolation 1. 2. 3.…
A: Temporal isolation is when species that could interbreed do not because the different species breed…
Q: What is the advantage, if any, of direct development in gnathostomulids? 2. What are the…
A: Gnathostomulids is the marine worm while rotifers are multicellular organism.
Q: PAMPS, TLRs, interferon
A: Human immunodeficiency virus (HIV) is a virus which attacks the human (body's) immune system. it…
Q: giving examples to illustrate your answer define both selective media and enrichment media as might…
A: Every microbiologist must eventually grow bacteria in the lab for research purposes. Bacterial…
Q: Part A: A wild-type fruit fly with a smooth body, straight wings, red eyes and paired antennae (br+,…
A: Answer given in step 2. Please find the attached immage. Thank you.
Q: ewith a long tailed mouse. Multiple cresses of this short-tailed mouse to long-taled mice produces…
A: Genotype can be refer to a gene or set of genes that leads to a single trait or disease.
Q: List all the etiologic agents of superficial and cutaneous mycoses
A: Fungal infections, also known as mycoses, are responsible for a wide range of diseases in humans.…
Q: Energy is released reactants AG <0 products Time This graph shows an reaction. Gibbs Free Energy
A: This graph showing exothermic reaction.
Q: Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region.…
A: Lumbar region is the lower back region including the spine,consists of five vertebrae labelled…
Q: AT THE ESTIMATION OF THE VALUE OF THE COEFFICIENT OF NATURAL LIGHTING, USE THE DEVICE 1. Krotov's…
A: Krotovs apparatus used for bacteriogical air research. Cathetertometer is urine meter. Anemometer…
Q: Phosphorylase kinase integrates signals from thecyclic-AMP-dependent and Ca2+-dependent…
A: Phosphorylase kinase which is abbreviated as PhK, has the responsibility to coordinate hormonal as…
Q: cance of color blindness in humans is due to a recessive gene located on the X chromosome X linked).…
A: Mother × father XXc XcY Progeny - X Xc Xc XXc…
Q: Portal System 1. What visceral organ system uses the portal system extensively?
A: Portal system in the body can be defined as a system in which blood present in one set of…
Q: abel the muscles on the dorsal and ventral sides of the frog. 1 2 10 3 11 12 13 14 15 8 16
A: Frog muscles: In frogs different types of muscles can be found that help the frog in performing…
Q: To explain: The reason why the movement of H* ions is faster than Ca²* ions. Also how this speed…
A: Ions play a variety of roles in cellular functions such as electrical communication (Na+, K+, Ca2+),…
Q: 4. Give at least 2 major contributions of Cambrian explosion to evolution. 5. Define human…
A: Human evolutionary genetics investigates how one human genome differs from another, as well as the…
Q: In the following cases of disputed paternity, determine the probable father by writing Father 1 or…
A:
Q: To determine: A defining characteristic of the innate immunity.
A: The immune system's most notable trait is its ability to remember things. Memory is an important…
Q: Can you determine if a plant is a monocot or dicot just by looking at the pattern of the roots? The…
A: Introduction In vascular plants, a vascular bundle is a constituent of the transport system. The…
Q: 1. Explain the role of Statistics in biological science.
A: Statistics is the discipline that concerns the collection, organization, analysis, interpretation,…
After Eating a pizza
Tomatoes and Pizza Dough =Producers – 10,000 or 20,000
Cheese – Primary Consumers = Level 2 -1,000
Pepperoni and Saugage – Level 3 (Pigs and Cows) 100
Me (Tertiary Consumer) 10
Using Trophic Level Diagram below Calculate the total energy consumption once you are done eating this
meal.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- C Clever | Portal A Did you firnish your interim? If no x e Edcite Q 14| 2021 SCI_G8_12_MI X A edcite.com/apps/MOElemViewer?assignid%3=nhaadmin_1611780315611&exid%3Dnhaassessmen Use the information below to answer the question. Below is a model that traces the movement of energy and matter within an Amazon rainforest ecosystem. Ocelot Jaguar Carbon dioxide Golden lion Woolly monkey tamarin Long-horned grasshopper Dead-leaf moth Banana plant Bromeliad plant * Fungi Oxygen Review/End Test Flag Options This assignment uses a Viewer designed by Edcite to meet the needs of students to the state assessment provider. As such, the Edcite viewer may diff 2013-2021 EdciteC Clever | Portal e Edcite Q 15 | 2021 SCI_G8_12_MI X A Did you finish your interim? If no A edcite.com/apps/MOElemViewer?assignid%3Dnhaadmin_1611780315611&exid%3Dnhaassessn Use the information below to answer the question. Below is a model that traces the movement of energy and matter within an Amazon rainforest ecosystem. Ocelot Jaguar Carbon dioxide Golden lion tamarin Woolly monkey Long-horned grasshopper Dead-leaf moth Banana plant Bromeliad plant Fungi Oxygen Review / End Test Flag Options This assignment uses a Viewer designed by Edcite to meet the needs of students to pr the state assessment provider. As such, the Edcite viewer may differ 2013-2021 Edcite, InThe loss of an apex consumer would impact which trophic level of a food web? primary producers primary consumers secondary consumers all of the above
- S Student eBook Resource Use an X a legacynv.schoology.com/common-assessment-delivery/start/4725620814?action=Donresume&submissionld%3D4319 Resource Use and Earths Systems: Lesson Quiz Which of these activities or processes might affect the supply of groundwater in an aquifer? Select all that apply. O raising livestock on a farm V drought O excessive rainfall O processing materials in a factory 1 here to search5 x core.learn.edgenuity.com/player/ + ence- SC5181 A ↑ 3 2 Mark this and retum C 6 7 8 Which of the following is a valid comparison of the net primary productivity of a salt marsh to the net primary productivity of the ocean? O The salt marsh has a higher net primary productivity because it is smaller in area and volume. O The salt marsh has a higher net primary productivity because it has higher salinity O The ocean has a higher net primary productivity because it is larger in area and volume O The ocean has a higher net primary productivity because it has more organisms producing carbon. 0 % 5 омо A 6 Oll DELL & 7 O * 8 O Save and Exit ( 9 ) O Next <☆ English 4 Submit Oct 7 Kinley Heath 40 LO X □: 2:04 0 D + = ( backspaNew Tab A districtIms.seattleschools.org/common-assessment-delivery/start/5508160845?action3Donresume&submissionld=717153018 Ecosystems HW Quiz POSSIBLE POINTS: 2 Match whether the following occur in plants, animals, or both. Carbon enters the organism as CO2 Carbon enters the organism as LOMS Biosynthesis builds SOMS into LOMS Glucose is the starting SOM for all biosynthesis :: animals :: plants :: both 1 4 5 6. g Schoology- Google C... Social_Media_PPT_Te...
- Unit 9/10 review sheet 1. Analyze the following food web. Identify and section off each of the trophic levels. Label each level. Identify and label the primary producers, primary consumers, secondary consumers, and tertiary consumers. Label where you find herbivores, omnivores, and carnivores. Smaller toothed whales Baleen.whale Sperm whales Penguins Elephant seal Leopard seal Other seals Other birds Fish Other herbivorous zooplankton Krill Carnivorous zooplankton Phytoplanktone-SC5 x + 19.core.learn.edgenuity.com/player/ Science - SC5181 A Use the diagram of the nitrogen cycle answer the question. Nitrogen Cycle Ammanification De Mark this and return C NO, in the atmosphere Nitrification 10-0 NH₂ Oll Nitrogen fxation N₂O DELL Densitification Save and Exit Next ✰ ✰ 0 English Kinley t Submit Oct 6 3:43cter X Edio | Course Student X List 1 characteristic thX RepostExchange | Rec 089956/lessons/1533882/variants/1533882/take/5/ A * Practice MATCHING LIST Сycles Match each vocabulary term to its definition. recycling of matter between liv- a. water cycle ing things and the environment b. reservoir part of a cycle that holds a sub- stance for a short period of time C. nitrogen fixation water held below Earth's surface d. carbon cycle portion of a cycle that holds a substance for a long period of time biogeochemical cycle е. change from solid directly to gas f. exchange pool recycling of water through living sublimation g. and nonliving things h. sedimentation recycling of carbon through living and nonliving things ke/5/
- O Home - Student Portal S Savvas EasyBridge S Savvas Realize savvasrealize.com/assignments/viewer/classes/61227fd32e855b44e0a77ded/assignments/d048f0a52da74003bb7f27901b658079/cont y: Ecological Pyramids Pyramids Instructions Red-tailed Coyote hawk Third-level Grasshopper consumer mouse Second-level, consumer Speckle-winged grasshopper First-level Cottontail rabbit consumer Primary Producer Bluegrass acerUnit 1: Fo x O Dashboard O What are EI Nino x O Copy of Exhibitio O Work on Exhibitic x QhcKKILgKyul.euV791u2MGONIk07CITIR21al/edit#slide-id.ged38e15Sa39 0 204 D Present- Tools Add-ons Help Last edit was 3 days ago D Background Layout- Theme Transition Trophic Cascades Part 2 - Interactive part 1 What does a solid line indicate? What does a broken line indicate? Add arrows, [+] and (-) to the diagram below. Otter Kelp Urchin ker notesBIodiversily Instructions: Answer the following question in complete sentences. Ecosystem A Ecosystem B Which ecosystem has the highest biodiversity? Explain why. Туре Here O 2018 Academic Fiesta