AKS 5c1: The model below represents the process of protein synthesis. What is the best description for what occurs during process A and process B in the model? * TT AA AA GAA IG |A AMGAAGI IB FA
Q: Describe the different stages that process of Protein synthesis.
A: Protein synthesis is the cycle where cells make proteins. It happens in two phases: transcription…
Q: Please answer fast Give ans for each statement 1.A protein linked to a disease state is being…
A: A protein cause disease if it misfolded and aggregared even though it has same amino acid…
Q: Please answer fast List the steps of protein translation. Briefly summarize the mechanisms…
A: Genes include instructions for making proteins. They do not, though, produce proteins directly.…
Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…
A: The genetic code is which allows DNA and RNA sequences to be decoded into the amino acids of a…
Q: UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?
A: The set of "rules" that a cell uses to decipher the nucleotide sequence contained in an mRNA…
Q: C 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…
A: DNA is ladder like , two strand structure that act as genetic material in most of Organism.…
Q: Protein: Hemoglobin Circle and underline each codon, amino acid sequence, make a mutation of the 3rd…
A: Here the not cleared the mutation type, are point mutations, frame shift mutation, addition mutation…
Q: 5. Answer the following questions concerning protein synthesis a. Describe with drawings how…
A: Protein synthesis is known as translation process that perform synthesis of amino acid chain or…
Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…
A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…
Q: 16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription…
A: Proteins are polymers of amino acids formed via peptide bond between two amino acids .
Q: biguitation lêdds to . Degradation of protein into amino cids =. Attack of ubiquinated protein by…
A: Ubiquitylation (sometimes called ubiquitination or ubiquitinylation) is an enzymatic…
Q: AKS 5c1: Given the statements below, what is the correct sequence of events for protein synthesis? *…
A: Translation is the process of formation of a sequence of amino acid using messenger RNA as a…
Q: 9The table opposite shows the triplet codes for the 20 amino acids involved in protein synther A…
A: Codons are three DNA sequence triplets that code for specific amino acids and there are a total of…
Q: AKS 5c1: Which of the following models BEST represents heredity at the cellular level?* O MRNA (UAC…
A: Heredity is the summation of all biological phenomena through which specific characteristics are…
Q: AKS 5c1: The model below shows the process of protein synthesis. What is the best explanation for…
A: DNA (Deoxyribonucleic acid) is the hereditary material present in most of the living organisms,…
Q: Using seven numbered steps, describe the process of translation.
A: Translation : It is the process of translating the sequence of mRNA molecule to a sequence of amino…
Q: AKS 5c1: Which of the following demonstrates the correct sequence of events that occurs during…
A: The correct sequence of events is given below.
Q: 2. Describe the process that is occurring in this image protein nibosome
A: The proteins are the final product of a gene that perform all the functions within the cell.…
Q: Describe the process of protein synthesis and localize where each step takes place.
A: Protein synthesis is the process wherein cells make proteins. It happens in two phases:…
Q: 10. Which of the following is not involved in the biosynthesis of a protein molecule? 1. Codon 2.…
A: Cellular organisms contain DNA in each and every cell which acts like a genetic information…
Q: 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA…
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymeric molecules essential in various…
Q: Indicate the phase of protein synthesis during which each of the following processes occurs: a. A…
A: The process of synthesis of proteins is called translation. Translation occurs in mainly three…
Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…
A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…
Q: protein synthesis 2 When the DNA sequence TGACT is copied to RNA, the sequence in RNA will be Select…
A: The Central Dogma of Molecular Biology shows that DNA is converted into RNA, which further makes…
Q: C9. The peptide “backbone" consists of repetitive "“units" of amino group nitrogen-alpha…
A: Proteins are biopolymers made of amino acid units. Amino acids are comprised of carbon, hydrogen, a…
Q: Many protein modifications take place in the endoplasmic reticulum (ER). Name one ER enzyme (and…
A: Note- frame the question correctly and repost it. Thank you!!
Q: Why might a person make bad personal or lifestyle choices if she had knowledge of her genome?
A: It has been also studied that people who ate more raw fruits and vegetables had a reduced risk of…
Q: b. 3, 20, C. 4, 20 d. 20, 4 necessary for protein synthesis to occur: a tRNA b. MRNA c. ribosomes d.…
A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…
Q: characteristics Part 1: Function of Protein Sunthesis and Gene Expression code protein trait It's in…
A: A gene is a sequence of nucleotides in DNA which codes for a particular functional protein. Genes…
Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTY by Smith 4th Edition
A: mRNA or messenger RNA is a polymer of ribonucleotides that has a sequence corresponding to the…
Q: What's the role of DNA in protein synthesis? What occurs during transcription and why is it…
A: Central Dogma: It explains the flow of information(genetic) from DNA to RNA that is needed to make a…
Q: Vhich of the following types of RNA participate in protein synthesis by bringing the amino acids to…
A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…
Q: .GTCTCTTGACATTG... 3' the nucleotide highlighted in yellow is mutated to a C, what consequence will…
A: Mutations are changes that occur in the genetic sequence of an organism. These mutations have an…
Q: DNA Template: 5' (?) MRNA (?) 3' 3' GGTCAGATGTGCGCGACGGGCAATCCGCACGTGTCATCAATAGTGCCTTCGTCTGAGATC 5'…
A: DNA subsists inside the nucleus as a double-stranded particle. Some regions of DNA include genes…
Q: 10. Explain the difference at the molecular level in how temperature and urea denature a protein.
A: The three dimensional structure of a protein is held together by noncovalent interactions like…
Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…
A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…
Q: State silent feature of genetic code?
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: Discuss the difference between intron and Exon
A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…
Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…
A: Transcription is the process where the genetic information on the DNA strand is transferred into an…
Q: Please draw the protein synthesis
A: Introduction Protein synthesis, also known as protein biosynthesis, is a fundamental biological…
Q: 21. Know how to complete this and similar Tables. DNA т т т mRNA TRNA Amino Acids
A: The given table could be filled up by using the Watson-Crick base pairing rule and the codon table.…
Q: State if/how Remedios' mutation changes the amino acid sequence and describe the effect that change…
A: CAT codes for HISTIDINE. CGT codes for ARGININE Since the mutation has changed the final amino acid…
Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…
A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…
Q: Discuss DNA to RNA transcription in a simple way (
A: Definition : Process of copying a segment of DNA into RNA is known as Transcription. In simple,…
Q: The role of mRNA in protein synthesis is that it ____.
A: Proteins synthesis is the most important essential and significant metabolic activity of the living…
Q: 2. Manufacturing biological molecules in the laboratory requires the use of relatively pure…
A: In a cellular compartment, the synthesis of biological molecules takes place in a series of steps…
Q: Protein synthesis, begins with a process known as pre-initiation. Explain three scenarios that would…
A: Initiation factors are proteins binding to the smaller subunit of the ribosome during the initiation…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 3 steps with 1 images
- pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anSA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omiss
- AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine QGTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
- Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…Explore: Codons Found in Messenger RNA Second Base U C A Cys u Cys c Stop A G Phe Ser Tyr Tyr Stop Stop His Phe Ser Leu Ser Leu Ser Trp Leu Pro Arg Arg Arg G Leu Pro His Leu Pro Gin Leu Pro Gln Arg le Thr Asn Ser U A lle Thr Asn Ser le Thr A Lys Lys Arg Arg Gly Gly A Met Thr Val Ala Asp Val G Val Ala Asp Glu Ala Gly Gly Val Ala Glu Mutation #1: • Change the Mutation to RED Original DNA Sequence: TACAC CTTGG CCGACGACT mRNA Sequence: A UGUG GA ACCG CUG C UGA Amino Acid Sequence: MET -TRP- ASN - ARG- CYS - (STOP) Mutated TAC ATC TTG GCG ACG ACT DNA mRNA AUG Amino Acid МЕТ- MET - Will this mutation have an effect? What kind of mutation is this? First Base Third BaseD. The sequence of a eukaryotic gene is given below, where in boed an inset containing: 5'GA TTATGGAATTCACCTAT GATCGCAT GGCCATTGAACCT 3 3CTAATACETTAAGTGGATA CTAGCGTA CCGGTAACIT GGA 5 A. Write the sequence of the WRNA produced by its process of transcription and of wRNA that is transferred to ribosomes in order to produce the peptide B. A mutation has occured in the above gene. The GIC pair highlighted replaced by T/A. Cells that are homozygous for that mutation become Cancerous. Do think this gene is a you proto-oncogene? or a tumor suppressor gene and why? describes D₂. The following family tree is given which the way inheritance of a dease. It is noted that only one of its two persons generation I is heterozygous and that one of the individuals in subsequent generations exhibits unexpected Phenotype. Individuals II4 and III2 show its phenotype disease. The remaining individuals have normal phenotype. α
- point: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三 囲 Y pre-MRNA:| I囲2 LQuick activity Use the genetic code to translate the following 30 nt mRNA sequence: AUGAUCCUAGGGUGCAUGAUGCCAAAAUAA Prezi 1st letter UUU Phe UCU U UUC JUA UUG U CUA CUG Leu AUU A AUC lle AUA CUU CCU C CUC Leu CCC Pro CCA CCG UAU UCC Ser UAC UCA UAA UCG UAG ACU ACC Second Letter ACA AUG Met ACG C GUU GCU G GUC Val GCC GUA GCA GUG GCG AAU Thr AAC AAA AAG Ala CAU His CAC CAA Gin CAG GAU GAC A GAA GAG Tyr UGU Cys U UGC Stop UGA Stop Stop UGG Trp CGU CGC Arg CGA CGG Asn Lys Glu G AGA AGG Asp GGU Arg DCAG DCA AGU Ser U letter AGC GGC Gly GGA GGG A U VAG U JOJO 3rd G AlbBONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNA