Q: Create a diagram showing the commercial hormone production using biotechnology
A: Medical experts continue to find new medications that aid in the treatment of deadly diseases and…
Q: what causes low white blood cell count? Detailed
A: Reduced by blood cell count is a condition called as leukopenia. This condition could be fatal if…
Q: List down and briefly describe three other sequence alignment tools other than BLAST used in…
A: BLAST can rapidly align and compare a query DNA sequence with a database of sequences, which makes…
Q: Answer the following questions in paragraph form of at least five sentences. 1. Differentiate…
A: The mechanism which results in sealing of a leaking or severe blood vessel to stop bleeding is…
Q: 1. The tunica media of blood vessels contain the following structures except _____. A. endothelial…
A: The heart's role in any organism is to keep "blood" flowing continuously throughout the body. Blood…
Q: properties of virus particles
A:
Q: 54. Which of the following plant hormones causes delayed leaf senescence? а. ethylene b. auxin C.…
A: correct answer;- cytokinin Explain;-Cytokinins are plant-explicit synthetic couriers (chemicals)…
Q: Consider Cyclic Crossover on two Parent chromosomes: Parent1 = A0846172593B and Parent2 =…
A: The child chromosome will be... chromosome no 1 is... A94B5721608A chromosome no 2 is...…
Q: How did temperature affect heart rate? What do you suppose is a consequence of being a poikilotherm?…
A: Introduction The number of heart contractions per minute is used to determine the pace of the…
Q: Use the Dichotomous Key to ID a gram positive glucose fermenter that has the catalase enzyme.…
A: Dichotomous key It is a scientific tool identifies the different organisms on the basis of the…
Q: Based on the information in the food web, drag the organism label to the appropriate box to indicate…
A: Introduction :- Primary producers, or autotrophs, are creatures that get their energy and materials…
Q: Interconnected cavities within the brain are called _____; they contain _____. a- ventricles;…
A: Brain and brain cavities :-
Q: Scientific Name:____________________ Most damaging stage of this pest:…
A: Mango pulp and seed weevil called as mango fruit weevil.
Q: QUESTION 1 The Wnt signaling pathway component, Dsh, effects the action of B catenin by: O A.…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 6: Regarding thioamides: (a) they include chlorambucil (b) methimazole is less potent than…
A: Thioamides are the class of drugs with thiocarbonyl group which is used to treating thyrotoxicosis…
Q: Give the broad definition of Annelida.
A: Introduction Phylum Annelida belongs to the kingdom Animalia. They are found in both aquatic and…
Q: Question Discuss, How wil you characterize the Bing eating ?
A: Binge eating involves the consumption of large quantity of food very quickly, even when not hungry,…
Q: What are the applications of ?contact lenses
A: ANSWER;-
Q: Pa,ents with damage to the amygdala of their brains do not _____. a- feel pain b- recall images…
A: Brain is the complex part of our body which is made up of millions of neurones and it control…
Q: Draw the insect and the host Pest Coffee berry borer Scientific Name:____________________________…
A: Berry Borer or Coffee Borer Beetle is an insect found in the coffee seeds and damaging it…
Q: Lạc Y [ Choose ] operator [ Choose ] Lạc Z [ Choose ] operon [ Choose ] trans-acting [ Choose ]…
A: Introduction:- Lactose metabolism genes are found in the lac operon of E. coli. It is only expressed…
Q: To determine: The trophic levels and the way in which they are related to ecological pyramids.
A: The Sun sends light to the Earth. The energy source is very efficiently used by the organisms for…
Q: b)Explain the differences between PMDIS and DPI
A: pMDIs, DPI, and nebulizers are the devices used in inhalation with an objective to convert the drug…
Q: Table 1.1 Number people suffering Cigarretes smoked Year chronic bronchitis per 100.000 per person…
A: Positive correlation occurs when variables move together. This means changes in one variable will…
Q: Deoxygenated blood is returning to your heart from your head. What is the order of the structures of…
A: Heart is a chief pumping muscular structure which helps in sending oxygen rich blood to all parts of…
Q: A patient with poorly controlled Type I diabetes has blood drawn and finds that the pH of his blood…
A: Alkalosis and acidosis Alkalosis defines a condition when the pH rises above 7.45 And acidosis is…
Q: that the cell was described for the seventeenth century, what led scientists to formulate the cell…
A: Introduction: A cell is a cytoplasmic mass that is outwardly bound by a cell membrane. Cells are the…
Q: What is Nondisjunction? How is it linked to meiosis, mitosis and cancer?
A: Nondisjunction is the failure of homologous chromosomes or sister chromatids to isolate subsequently…
Q: At high altitudes, a person will start to develop more red blood cells. This response is due to an…
A: Introduction :- The red blood cells in your body transfer oxygen from your lungs to your tissues.…
Q: Differentiate the digestive system in terms of anatomy and physiology of ruminant and monogastric…
A: INTRODUCTION Ruminant, is any mammal of the suborder Ruminantia, which incorporates the pronghorns,…
Q: I. Water enters and leaves cells through what process? A. Active transport B. Diffusion C. Osmosis…
A: Introduction Transpiration:- It is the loss of water in the form of water vapor from plants…
Q: For each genotype below, indicate whether it is heterozygous or homozygous. Write PAUL if its…
A: Genes are specific sections of DNA that contain the instructions for one protein. DNA's genetic code…
Q: What are the different types of haemolytic reactions?
A: Introduction The breakdown of red blood cells is known as hemolysis. Certain microorganisms are…
Q: Provide the correct sequence of steps in each process described below. Write the letters in series…
A: DNA or Deoxyribonucleic acid is the genetic material contained in most complex, higher organisms. It…
Q: 3. How does metamorphosis reduce competition between adults and immature forms? 4. How are the…
A: The phylum Arthropoda contains the biggest group of invertebrates (creatures lacking a spinal…
Q: The following map shows a test crossing experiment that was conducted to find out the relative order…
A: Double cross over would happen if two cross over takes place at the same moment. That means only the…
Q: 7. Prunus persica (peach) Simple 8. Oryza sativa (rice) 9. Acer sp. (maple) Simple 10. Morus nigra…
A: A fruit is a structure containing one or more seeds. After fertilization fruit is developed form…
Q: 1. During the Neolithic Revolution, all humans switched from a hunter-gatherer lifestyle to an…
A: Neolithic revolution is also called agricultural revolution. All humans switched to agricultural…
Q: what is a transport medium; give specific examples and state their purpose
A: What is a transport medium; give specific examples and state their purpose?
Q: REPRODUCTION PLANTS ANIMALS Can reproduce asexually? If Yes, write the different ways on how they…
A: Reproduction is the biological process by which new individual organisms – "offspring" – are…
Q: Why should a young culture be used in gram staining rather than an old culture? b. Why is it…
A: To answer this question first, we need to understand what is gram staining and what are the steps of…
Q: What is MRSA? In your own, words describe why MRSA is so concerning.
A: Methicillin-resistant Staphylococcus aureus (MRSA) disease is acquired by a staph bacteria that has…
Q: Question 14 Which of the following is an example of a homologous structure? O the jointed leg of an…
A: There are 2 types of structures which serve important basis for the evolutionary evidences.…
Q: Compare and contrast the structure and function of two important organelles in either an animal or…
A: An organelle is a subcellular component which, like an organ in the human body, has one or more…
Q: Proteins are always functional as single protein fibers with nothing attached can never form…
A: The correct answer is - proteins sometimes require additional molecules to be bound to them in order…
Q: discuss the what is cyst passers and its type 2. which body organs do E. histolytica resides? 3.…
A: Entamoeba is parasitic or can be commensal organism . It is characterized by presence of tiny one…
Q: Fill in the blanks to make this sentence correct: When the solute concentration in the blood is…
A: Anti diuretic hormone and its function :-
Q: Why is the internal shell of Cephalopods significant to their adaptation?
A: Cephalopods have huge, advanced brains, and their brain-to-weight proportion is the biggest among…
Q: answer the following question in paragraph form at least five sentences. 1. Differentiate intrinsic…
A: Homeostasis, as currently defined, is a self-regulating process by which biological systems maintain…
Q: difference
A: The Electrophysiology studies called as EPS were usually performed to diagnose the arrhythmia and…
Align your two superimposed fragments and look for a repeat
Step by step
Solved in 2 steps with 1 images
- Please answer asap and type your answer and do not copy from anywhere please An alien bacteria is found on Mars and is found to contain double stranded DNA. A culture is performed with the bacteria on medium containing radioactive thymine (represented by T*) until all of the thymine in the DNA is radioactive. The culture is then transferred to a medium containing nonradioactive thymine (T). Samples are removed after one round of DNA replication and one portion of double stranded DNA is selected. Two different types of double stranded DNA was identified: Type 1 Type 2 5’ A T*T*T*C G 3’ 5’ A T T T C G 3’ 3’ T*A A A G C 5’ 3’ T A A A G C 5’ What type of replication must be occurring?Which of the ff is incorrect?Figure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining steps needed to obtain the desired sequences (a different fournucleotide sequence on each of the four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide sequence attached at each spot.
- Compute the percent identity of the following pairwise sequence alignment: -TGAGACTTAGAGT |..|... | | | | | ATAGGAGCGAGAGTTAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that would be formed by translating this plece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids, Use the abbrevlation of the amino adid exactly as Itswritten in the table (including the appropriate capltalizations For example it your answer for amino acid 1 is"Methionine" you would write MET in the box (not Met or met) Second Later UUU UUUC Phe UCU UAU Ser UAC UAA UAG Tyr UGU Cys U Leu UCA ucG UGC Stop uGA Beop UUG Step UGG Trp G Cuu C cuC CUA CUG CU Leu Coc CCA CG CAU Pro cGu CAC CAA CAG His CGC Arg CGA CGG 1st 3rd letter AUU A AUG AUA AUG ACU le AAU AAC AGU ACC Asn Ser U leBer ACC ACA Mct ACG The AAA AAG ACA Lys AGG Arg acu Val GCC GCA GCG GAU GAC GAA GAG GOU GGC GGA GGG Arp G GUC GUA GUG Ala Gly Glu Seovence of the protein, 1st amino acid. 2nd arnino acid: 3rd amino acid: 4th amino acid Sth amino acid: 6th amino acid: 7th amino…Question 9 Review concepts 21.5-21.6. Match term and its description. the mechanism contributes to polyploidy | Choose ) rearrangements of parts of genes due to meiotic errors |Choose one or multiple copies of a gene or genetic regions at loci in some | Choose J humans consequence of duplication, rearrangement and mutation of DNA [Choose J
- Identify the FOUR sequence.Please answer asap and type your answer and do not copy from anywhere please NOTE*** double stranded complementary DNA I have determined is GTCATACCTAGGGTA with a palindromic site of CCTAGG and the enzyme BamHI that will cut the recognition site. In the double-stranded DNA you have determined, there is also another recognition site for common restriction enzymes. Which enzyme would cut your DNA at this other recognition site? (Hint: Remember that one recognition site can overlap with or be completely contained by the sequence containing another recognition site.) HindIII Sau3AI AluI BamHIBased on your gel, how big are the DNA fragments in each lane? Enter your results in Table 2.
- Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full sequence atggaatataactctagtccacattccggtgcattttttccaatcgggtcagactcaggatccaaatctccttgtggcagcgtgaacgtcgtctcctctgatggagatggttcaggtgggaatgggagtgaLooking at each of the fragments (100, 200, 300 base pairs etc.). Why are there so many of the fragments produced by the pure 1.3-kb fragment? (might have to show diagram)EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .