An E. coli replication fork is shown in Figure 2.2. III 3' IV 5 II Figure 2.2 (i) Circle and label the locations of helicase and topoisomerase in Figure 2.2.
Q: Using the chart below, can you produce a two-step procedure that demonstrates protein purification i...
A: Proteins are polymers of amino acids linked by peptide or amide bonds. Charge on the protein depends...
Q: Substrates and reactive groups in an enzyme’s active site must be precisely aligned in order for a p...
A: Enzymes catalyse (speed up) chemical reactions; in certain situations, enzymes may make a chemical r...
Q: My question is Explain why you feel numbness when using a topically applied pain cream that cont...
A: Lidocaine is an an anesthetic and it leads to numbness of that particular area in which it is applie...
Q: What methods are used to quantitate urine ketones? Which ketone(s) do they detect?
A: Introduction: Ketone bodies are metabolic products that are produced in excess during the excessive ...
Q: Part I. Answer the following questions in 5 to 7 sentences. 1. What are pentoses? What are the roles...
A: Carbohydrates are also known as hydrates of carbon. They contain elements such as carbon, hydrogen, ...
Q: How does the bioavailability of metal ions differ based on complexation with polysaccharides or amin...
A: There are three common terms used in soil science in relation to metal ion and its absorption and ut...
Q: Draw a triacylglycerol containing three units of 18:3 (9,12,15).
A: Triacylglycerol: This is lipid molecule made up by condensation of one Glycerol with three fatty aci...
Q: lanes for the blue and brown allele samples? (circle one) Brown sample: 0 1 Blue sample: 0 1 2 more ...
A: Agarose Gel electrophoresis is the molecular biology technique which helps in separation of gene se...
Q: 1.) What nitrogenous base would not be expected in structure C? 2.) What nitrogenous base would not ...
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which o...
Q: Respiratory paralysis. Tabun and sarin have been used as chemical-warfare agents, and parathion has ...
A: Biological warfare, often known as germ warfare, is the intentional deployment of biological toxins ...
Q: What is the effect of cholesterol when they are embedded in membranes? 1. Cholesterol alters the...
A:
Q: 18. Which one of the following factors should be on the x-axis of the graph to accurately describe e...
A: Enzymes are the biological catalysts that fasten the rate of chemical reactions. They are neither ut...
Q: Who is the father of biochemistry?
A: Biochemistry means the study of biomolecules presents inside biological organisms. It can also be de...
Q: The hydrolysis of proteins yields A. esters B. organic acids C. amino acids D. f...
A: Proteins are polymers of twenty naturally occurring amino acids amino. The amino acid residues in pr...
Q: Why is BSA used as a standard for protein content determination? Can other proteins be used instead?
A: Bovine Serum Albumin is a protein which is derived from cows. It consists of 583 amino acids, bound ...
Q: OH HO HO A NH2 Но. HO R-O. HO. HO HO R-O, OH Но HO `OH OH Но R-O, D HO. но но HO Но `OH OH B но. `OH...
A: Glycosidic bond is a type of covalent bond formed after reaction between hydroxyl group of carbohydr...
Q: Calculate the enzyme and specific activity of a reaction with 3 μM Hsp90 using the following inform...
A: Given Values: The molecular weight of the Hsp90 = 82.7 kDa Concentration of Hsp90 = 3 μM Molar Extin...
Q: I.G is a 35 year old patient with chronic liver disease. After operations he was on intravenous flui...
A: Given that, a 35-year-old patient has been diagnosed with chronic liver disease. When he was treated...
Q: Please answer clearly and directly Site an example why fats are important to maintain health and ba...
A: Given: An example why fats are important to maintain health and balance in the body and should not b...
Q: Which of the following affects the rate of enzyme driven reaction? rate constant air pressure conce...
A: Enzymes: Enzymes are biocatalysts that fasten the rate of a chemical reaction. It is proteinaceous ...
Q: With the aid of a simple generic diagram: i) IDENTIFY and EXPLAIN how the type(s) of chemical bondi...
A: The downloaded image of the 3GRS structure from PDB is as shown. This is the structure of Glutathion...
Q: Topic: Isolation of Crude Ovalbumin from Egg White by Ammonium Sulfate Precipitation (Salting Out) ...
A: Ovalbumin is an egg white protein which is responsible for egg white formation and has a molecular w...
Q: My PDB code: 3GRS residue point: 66 (LYS) mutation: VAL
A: 3GRD.PDB is the crystallographic structure of GLUTATHIONE REDUCTASE solved at1.54 ANGSTROMS resoluti...
Q: 2. The diagram below shows the structure of a sugar. ÇH2OH C=0 но H но H- ČH2OH Is the sugar an aldo...
A:
Q: Identify two other methods of protein content determination and differentiate them from the Bradford...
A: Proteins are the biomolecules that are made up of Aminoacids. Protein estimation is very important i...
Q: You have run a gel with 5 uL of amplified DNA in addition to 1 uL of 6X loading dye. Comparing the b...
A: Agarose Gel Electrophoresis (AGE), is an biochemistry technique which is used to estimate DNA concen...
Q: Complete Table 2.4 on your own. Calculate the volumes needed for preparing 1.00 mL of the remaining ...
A: For preparation of BSA solutions of different concentrations for the calibration curve from the stoc...
Q: What are the identities and functions of the components of the Bradford reagent in protein content d...
A: The Bradford method is a standard method used for determining concentrations of proteins in solution...
Q: Angiotensin Converting Enzyme (ACE) inhibitors cause blood vessels to relax, thereby reducing blood ...
A: Inhibitors of Angiotensin Converting Enzyme (ACE) reduces the blood pressure by relaxing the blood v...
Q: The following are structural diagrams of a selection of newly discovered amino acids. OH HO C-OH CH3...
A: The α-Amino acids are molecules made of a central C-atom (the C alpha carbon atom), that is bonded ...
Q: Draw the tetrapeptide Met-Ile-Lys-Glu at a ph of 12?
A: The pKa values of amino acid side chains play an important role in determining the pH-dependent char...
Q: 4. What is the major biochemical function for each of the following proteins? a. a Keratin b. Collag...
A: Fibrous proteins are proteins that have cellular or extracellular roles in behaving as a robust stru...
Q: After treatment with peroxyformic acid, the peptide hormone vasopressin is partially hydrolyzed. The...
A: Vasopressin, is an important hormone which has multiple functions in the body. It also known as anti...
Q: What is the definition of metabolism and what are the differences of catabolism from anabolism?
A: Glucose is the main substrate for carrying out cellular metabolism in the body, which is derived f...
Q: 10. Given a DNA strand with nucleotide sequence 3' CCGTTACCGC 5', how many hydrogen bonds are formed...
A: The 2 strands in a DNA molecule are linked to each other via hydrogen bonds. Hydrogen bonds are form...
Q: Calculate the pI value of aspartate. (iii) Calculate the pI value of arginine.
A: Amino acids are monomers that make proteins. The amino acids have a central carbon to which a variab...
Q: 4. For a simple enzyme-catalyzed reaction that follows Michaelis-Menten kinetics with Vmax = 75 µM/s...
A: Hi! Thank you for the question. We are authorized to answer two subparts at a time, since you have n...
Q: Density lipoprotein,reduces the risk of atherosclerosis by clearing out fatty plaques in the blood v...
A: There is unequivocal evidence of a negative relationship between plasma high-density lipoprotein (HD...
Q: how is phosphate utilized in humans?
A: Phosphate is derived from phosphoric acid. it is an anion, ester, or salt. A...
Q: in response to this question, could you explain why in Step 3, R became 0.500 and why in Step 4, Vma...
A: Michaelis menten constant, Km is the substrate concentration required to produce half maximum veloci...
Q: The following structures were introduced as neuromuscular blocking agents. Structure B is derived fr...
A: Here compound A and B both are choline derivative as both have Choline group at both end in the stru...
Q: What would happen if a protein with 3 subunits (molecular weights of the three subunits are 20 kDa, ...
A: SDS-PAGE ( sodium dodecyl sulfate-polyacrylamide gel electrophoresis) is used to separate the protei...
Q: 1. Calculate Vmax and Km???
A: Enzymes are usually a protein molecules that catalyzes the biochemical reactions without being consu...
Q: 5. Which of the following names best describes the molecule? CH2OH C=0 но- -H H- H- -OH ČH2OH A. Pen...
A: Since you have asked a question with multiple subparts, we will answer only first three subparts for...
Q: topic: Bradford Assay There are numerous methods of protein determination in use, but this module fo...
A: The Bradford assay is a dye-binding assay that is based on the changes in color of the Coomassie dye...
Q: The following structure is more active than morphine as an analgesic. H3C. CH3 H. H3C What is the pr...
A: The morphine-like effect is produced by opiates. These opiates are made from the opium poppy...
Q: Assume you have a long polypeptide chain of Gly-Val dipeptides linked end to end. Explain the likel...
A: Proteins have four levels of the structural organization including Primary, secondary, tertia...
Q: Based on the pk table for amino acids (Table 1.1), draw the structures with net charge, and the equi...
A: Acid strength is the tendency of an acid to dissociate and donate a proton. The value of pKa of an i...
Q: Why are buffers important in living systems? please explain
A: A buffer is a solution that can withstand pH changes when acidic or basic substances are added to it...
Q: What are the main structural features of the mucupolysaccharides chitin? How do this aid in its func...
A: Mucopolysaccharides are sugar polymer also called as Glycosaminoglycans. Such polysaccharides are wi...
Step by step
Solved in 2 steps with 1 images
- An E. coli replication fork is shown in Figure 2.2. III 3' IV 5 II Figure 2.2 (i) Identify the lagging strand template and the leading strand template in Figure 2.2. Identify the strand that is made up of Okazaki fragments.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.(i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z are the ends of the DNA and RNA strands respectively. Identify ends of DNA’s X, Y, and Z shown in Figure 1(a) & (b). (ii) (a) Telomerase -AAUCCCAAU- TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W’ AАТСССААТСССААТСССАА-Х" (b) Telomeric DNA Figure 1
- The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'.TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'.AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. d Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 -41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?Telomerase is a reverse transcriptase enzyme that carries its own RNA molecule (Figure 1(a)). The telomerase enzyme attaches to the end of the telomeric region (Figure 1(b)) for DNA replication. (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z are the ends of the DNA and RNA strands respectively. Identify ends of DNA's X, Y, and Z shown in Figure 1(a) & (b). (ii) (a) Telomerase -AAUCCCAAU- ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' ПAАTСССААТСССААТСССАА-Х (b) Telomeric DNA Figure 1The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5...ТTCGAGCтСТСGТСGTCGAGATACGCGATтGATATTACTGGTAATАTGGGGATGCACTATC...3' 3'..AAGCTCGAGAGCAGCAGCTCТАTGCGOТАСТАТААТGACCATTATACСССТАСGTGATA...5" promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?
- Figure 1 is a photography obtained after spreading the replicating Escherichia coli chromosome and its observation by transmission electron microscopy. An interpretation scheme of the observed structure is shown in the upper right part of the photo. Figure 1: Photography of a replicating Escherichia coli chromosome observed by transmission electron microscopy. 2 Indicate the replication properties that are shared by all living organisms What are the peculiarities of bacterial replicationThe beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACСАТТАТАССССТАСGTGATAG...5" promoter a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'A Meselson-Stahl-experiment was performed to study the DNA replication of a newly discovered bacterium. This bacterium takes 30 min to complete a round of replication at 37° C. Figure 2.1 shows the autoradiography of the replicating DNA molecule. В A C D Figure 2.1 (i) Based on the autoradiography structure (Figure 2.1), identify the point where replication in this bacterium could terminate.
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA replication. a) Please replicate the parental strands into two exact copies TC GATATCGG AGCTATAGCC b) place a centromere between the two replicated copies (or tell me where the centromere would be located),