Below is the DNA sequence of a gene, what is the protein sequence?5'-GGTAAGCTAGCTATGACTACCCTGACATAGATATCGACTAGCTG-3'Insert the amino acid sequence using the single letter designation for the amino acid(ex: use ACG instead of AlaCysGly). Include only the letters in the correct order asthey would be translated using no commas, no spaces and no dashes.

Name: Below is the DNA sequence of a gene, what is the protein sequence?5'-
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Below is the DNA sequence of a gene, what is the protein sequence?5'-GGTAAGCTAGCTATGACTACCCTGACATAGATATCGACTAGCTG-3'Insert the amino acid sequence using the single letter designation for the amino acid(ex: use ACG instead of AlaCysGly). Include only

Proteins are biomolecules composed of monomers called "amino acids" that are adjoined by per tidal…

Answered: Below is the DNA sequence of a gene,…

Science

Biology

Below is the DNA sequence of a gene, what is the protein sequence? 5'-GGTAAGCTAGCTATGACTACCCTGACATAGATATCGACTAGCTG-3'

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation
A portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........
On the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'
The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly
5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINY
The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine