Suppose a gene has the sequence ATGGGTTATCGCGAGTAC. A point mutation changes the gene to read ATGGGTTATGCGGAGTAC. How would the polypeptide product of this gene change?
Q: How many bypassed reactions does gluconeogenesis have? 10 2 3 6 1
A: The synthesis of glucose from the non-carbohydrate precursors is called gluconeogenesis. Major…
Q: 2. Suppose you had allowed your dialysis experiment to continue for several days (with the beaker…
A: As given in the question, the dialysis experiment was continued for days with the beaker covered,…
Q: What are some combustion and oxidation-reduction reactions that occur in the body?
A: In an oxidation reaction: oxygen is added to the molecule loss of hydrogen by the molecule loss of…
Q: Which of the following is incorrect? a. The ratio "catalyzed rate/uncatalyzed rate" is known as…
A: Catalysts are compounds that alter the rate of reaction and do not get consumed during the reaction.…
Q: 4. Which of the following peptides would absorb light centered at 280 nm? a. ala-lys-tyr b.…
A: The aromatic side chains of the amino acids are responsible for the absorption of UV light. The…
Q: Consider a mixture comprised of the proteins below: Protein that will most strongly bind to an…
A: Chromatographic techniques are used to separate specific molecules from a mixture of different…
Q: Which of the following is incorrect about the triacylglycerols? a. If they are of animal origin,…
A: Triacylglycerols, commonly known as triglycerides, are the most widely recognized type of lipid.…
Q: How many net molecules of nucleoside triphosphate (ATP and equivalent molecules) are produced by…
A: As you have posted multiple unrelated questions we are supposed to answer only the first question…
Q: Prevalence is... the number of people that died from particular disease. the number of new cases of…
A: Introduction: The term epidemiology refers to the study of the distribution frequency (person,…
Q: QUESTION 2 An isocitrate dehydrogenase assay was performed on the enzyme sample and found to give an…
A: Given Values: ∆A = 0.5 per minutel = 1 cmε=6220 M-1cm-1
Q: 1. Proteoglycans, such as heparan sulfate are defined as having sulfated glycosaminoglycans that are…
A: fggd
Q: 4. Lactose Intolerance (Enzymes) Carol was recovering from a terrible bout with the flu, having been…
A: Enzymes are a class of proteinaceous compounds that facilitate the successful completion of a…
Q: What is the rate-limiting step in the synthesis of acetyl CoA? oxidation regeneration of…
A: The first step in Krebs cycle requires Acetyl CoA and Oxaloacetate to form Citrate. But how is the…
Q: H₂N-CH CH₂ CH₂ + H₂O NAD+ NADH + H+ 9 =0 O=C CH₂ CH₂ + NH₂+
A: The enzyme commission has given the name for each enzyme in addition to their trivial names. It…
Q: I just read an abstract of the paper “Disulfide bond-disrupting agents activate the tumor necrosis…
A: The TNF or Tumour Necrosis Factor receptors are Cysteine Rich Domain (CRD) containing Receptors. It…
Q: You take the PKA catalytic subunit, the regulatory subunit, and the dimerization domains and mix…
A: As given in the question; the regulatory, catalytic and dimerisation domains of PKA were taken in…
Q: Integral proteins associate with the membrane through A. covalent attachment to lipids. B. covalent…
A: Cell membrane or plasma membrane is a dynamic, fluid structure which acts as a shield and channel…
Q: Describe the levels of structure of a protein and tell how they would be affected by: a. Hydrolysis…
A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…
Q: The following are an example of fat-soluble vitamins, except:* A. Vitamin D B. Vitamin K C.…
A: Vitamins are micronutrients that are required in small amounts in the diet. They are classified as…
Q: How does the hormone get from its secretory gland to its target tissue? • Are steroid hormones…
A: Since there are multiple questions in the image, I will explain the entire signaling cascade.…
Q: The sequences of four DNA molecules are given bel ii. TTTCCCGGGAAA AAAGGGCCCTTT iv. GCCGGATCCGGC…
A: DNA molecules are the nucleic acids that contain sugar, phosphate and nitrogenous base. Sugar is…
Q: Which of the following is true of the TCA cycle? It is independent of aerobic conditions. It is the…
A: Catabolism is the process by which complex molecules (consumed in the form of food) are broken down…
Q: Biological oxidation-reduction reactions always involve: a. direct participation of oxygen. b.…
A: Oxidation reactions involve a loss of electrons and reduction reactions involve gain of electrons.…
Q: After the removal of all sugar units from a ganglioside, what molecule remains? A. sphingosine B. a…
A: Lipids are one of the 4 major biomacromolecules, known for their easily distinguishable hydrophobic…
Q: Which of the following statements is true about active transport? A. The transported species always…
A: Active transport is a mode of transport of molecules against the concentration gradient using…
Q: Under what conditions will lactic acid accumulate in skeletal muscle? A. when citric acid enzymes…
A: Lactic acid is the end product of anaerobic Glycolysis where Glucose is oxidised to lactic acid.
Q: Which of the following is incorrect about the glycerophospholipids? a. They are not amphipathic Ob.…
A: GlyceroPhospholipids are the important components of biological membranes. They are diglycerides and…
Q: Riboflavin gives rise to cofactors: Select one: O a. All of them O b. FAD; FADH2 O c. NAD+; NADH d.…
A: Introduction: Riboflavin is likewise known as Vitamin B2. It is an important food supplement.…
Q: 3. Below is a polypeptide with an unknown number of amino acids. On the diagram below: a. Circle…
A: Amino acids are building blocks of proteins. Proteins are the polymers of amino acids. A protein is…
Q: 1. What are the products of beta oxidation of a 21-carbon fatty acid? (Provide the number of each…
A: Fatty acids are the important components of lipids. Simple lipids are composed of fatty acids that…
Q: All of the following are mechanisms for regulating enzyme activity in the cell, except: a. Rate of…
A: Enzymes catalyses a reaction, they remain unchanged after the completion of reaction. They just…
Q: The recognition sequence for the restriction enzyme Sau3AIis GATC; in the recognition sequence…
A: Given; The recognition sequence for the restriction enzyme Sau3AI is GATC. The recognition sequence…
Q: Conjugated proteins which are a combination of amino acids and carbohydrates O A. nucleoproteins OB.…
A: Based on the composition, proteins are of two types, simple and conjugated proteins. The simple…
Q: Fill in the blanks 1) The interactions between biomolecules and, proteins fold, and are exerted…
A: Amino acids are the structural units of proteins. Peptides are chains of amino acids joined through…
Q: A shortage of available ATP would hinder a cell's ability to import Select one: a. water. b. oxygen.…
A: The movement of molecules inside cell is governed by the plasma membrane that encloses it. The…
Q: consider 15 NADH and 43 FADH2 molecules funneling electrons into the electron transport chain…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate…
Q: 2. 3. 4. Give an explanation for your results with the distilled water. Which solution was…
A: Osmosis describes the direction in which water will flow when two solutions are separated by a…
Q: Macronutrients provide us the energy to live, move, and function. Evaluate the sentence above,…
A: Bioenergetics refers to the study of living system and it's energy transformations within and among…
Q: The enzyme that catalyzes the conversion of pyruvate into acetaldehyde plus CO₂ is named; Oa.…
A: Fermentation is a process of partial oxidation or reduction of a substrate into product.…
Q: hoose the conditions when PDH is activated. a) acetyl CoA/CoA ratio is high b) NAD+/NADH ratio is…
A: PDH is a regulatory enzyme situated in inner mitrochondrial membrane which is comprise of three…
Q: Jak Jak 1. Receptors bind cytokines, dimerize, and bind Jaks 2. Jaks phosphorylate each other and…
A: Since you have posted multiple questions with multiple sub-parts, we will solve first three…
Q: Which of the following is incorrect about lipids? a. Some contain polar groups referred to as "polar…
A: Lipids are biomolecules that are made up of fatty acids esterified to Glycerol backbone. Lipids have…
Q: Question 7 A sample was methylated and then digested, yielding a of 2,3-dimethylglucose and…
A: Glucose is a carbohydrate and it acts as the primary energy source for cells. Carbohydrates are…
Q: Which of the following is incorrect about the peptide Val-Leu-Ala-Ser-Gly? It has a net charge of…
A: H3+N-Val-Leu-Ala-Ser-Gly-COO- a) We have 1 positive charge at the N-terminal and one negative charge…
Q: 7. Why must a pencil be used for drawing the line and spotting? 8. How will the Rf value of a…
A: Thin layer chromatography (TLC) is a chromatography technique that can be used to separate…
Q: A sample was methylated and then digested, yielding a of 2,3-dimethylglucose and 1,2,3,6-tetramethyl…
A: Glucose is a carbohydrate and it acts as a primary energy source for the cells. Carbohydrates are…
Q: Carbon chains are principal features for both carbohydrates and lipids. What is the primary…
A: Introduction: Carbohydrates are large complex biomolecules that are aldehydes or ketone compounds…
Q: What is the event that ends the first stage of glycolysis? synthesis of NADH synthesis of…
A: Glycolysis is the first step of oxidation in glucose metabolism in which glucose is converted to…
Q: Which of the following interactions are due to the complementarity of the molecules: various…
A: Complementarity refers to the physical aspects or shape of macromolecules that fit one another in…
Q: Rate of glucose transport The below graph plots the rate of glucose transport through a membrane…
A: GLUT transporters are found in various tissues and these transporters are responsible for the…
Suppose a gene has the sequence ATGGGTTATCGCGAGTAC. A point mutation changes the gene to read ATGGGTTATGCGGAGTAC. How would the polypeptide product of this gene change?
Step by step
Solved in 3 steps
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.A gene contains 141 codons. How many nucleotides are present in the gene’s coding sequence? How many amino acids are expected to be present in the polypeptide encoded by this gene?Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'
- Given the following protein, which of the following sequences of TEMPLATE strand DNA would code for it? Pay attention to the polarity of the polypeptide and the strands of DNA that you choose. Use the codon chart to the right. AUG = met AAA = lys GCU = ala | CUU = leu ACU = thr -lys - thr - ala - leu - met (amino end) 5' TAC GAA CGA TGA TTT TAC ATT 3' 5' ATG CTT GCT ACT AAA ATG TAA 3' (carboxyl end) met 5' TAC TTT TGA CGA GAA TAC ATT 3¹' 3' TAC TTT TGA CGA GAA TAC ATT 5¹ 5' ATG AAA ACT GCT CTT ATG TAA 3¹ 3 TAC GAA CGA TGA TTT TAC ATT 5'(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5’ – A T G T T A C T A G T C – 3’ (b) The following section of DNA is used to build an mRNA for a protein: 3′—AAG—CTT—CTC—5′. What is the corresponding mRNA sequence?The peptide hormone oxytocin induces labor by stimulating the concentration of uterine smooth muscle. Its amino acid sequence is as follows: Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly.Write a messenger RNA sequence for that sequence. Write the sequence of the two strands of DNA nucleotides that carry the information. for that protein.
- Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA, and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 3' TCACAATACAAAGGTGTACTGATCTCATCTCCATAA 5'Use the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?The amino acid glycine is encoded by four codons: GGA, GGC, GGG, and GGU. Which of the following statements correctly explains this fact? The glycine anticodon contains the sequence CC, but the 5' base of the anticodon can pair nonspecifically with the 3' base of the codon. The glycine anticodon contains the sequence CC, but the 3' base of the anticodon can pair nonspecifically with the 5' base of the codon. Glycine tRNA has four anticodons, and the appropriate anticodon specifically pairs with the correct codon. There are four tRNAs for glycine, each of which has an anticodon that specifically pairs with the correct codon. all of the above
- The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?Suppose the codon sequence AUGACCCGGCUACUG has a single base pair mutation to AUGACCCGGUUACUG. If the old protein sequence was Met-Thr-Arg-Leu-Leu, what will be the new sequence encoded by the mutant gene?Sickle cell disease is caused by a so-called “point mutation" in the human B-globin gene. A point mutation is the result of a single base substitution in the DNA encoding a gene. The sickle cell mutation results in substitution of Val for Glu at position 6 in the B-globin protein. (a) Using the information in Figure 5.18 explain how a point muta- tion could change a codon for Glu to a codon for Val. (b) Do you expect the pI for the sickle cell B-globin to be higher or lower than the pl for wild-type B-globin? Explain.