The sequence below represents a strand of mRNA. Draw a box around the start codon. Then use the codon table provided, translate the mRNA and write the amino acids that are coded for. Remember that the start codon also codes for an amino acid. Stop at the stop codon. There is a stop codon. If you don't find a stop codon, you've missed something important. UAUG CAUG GUUA AUC
Q: Why should it make sense that a mitochondrion(a cellular organelle) is larger than a phospholipid…
A: Mitochondria (singular: mitochondrion) is the cell organelle that involves production of energy in…
Q: What will happen if you FAIL to do the following during bacterial cell staining. a. Smear…
A: INTRODUCTION Staining This is a technique that contrast a biological specimen at microspic level.
Q: Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…
A: Gaucher disease is caused by an accumulation of specific fatty compounds in organs, mainly spleen…
Q: C. Use of Antimicrobials - Disk Diffusion Method + Antibiotic used Ex. Amoxicillin E15 -…
A: An Antibiotic is a chemical substance used to inhibit bacterial growth or it is used to kill…
Q: A man develops a scrotal skin abscess following vasectomy. Which of the following sets of lymph…
A: Lymph nodes are small, round or bean-shaped structures that are found throughout the body. They are…
Q: Which of the following statements are correct about the ability of cancer cells to form a secondary…
A: Metastasis is the property of tumor cells to develop a secondary tumor at a site away from that of…
Q: When genes from two parents mix together to form the genes of their child, this is called a.…
A: A gene can be described as the basic unit of inheritance. A gene is transferred from one generation…
Q: Stomata likely evolved as a solution to which of the following land plant problems? Select an answer…
A: Plants are vital living forms that belong to the Plantae taxonomic kingdom and are further classed…
Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…
A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…
Q: In the figure illustrated, the sink for the material is in the atmosphere. True or false
A: Biogeochemical cycle is a cyclic pathway in which elements / nutrients are circulated in between…
Q: With the help of well labelled diagram describe the structure of a archaeal cell.
A: Archaea is a prokaryotic domain that are present throughout the biosphere. Many genera are…
Q: A 56-year-old patient calls the office requesting an appointment for a problem with his left leg.…
A: Introduction Thrombophlebitis is an inflammatory process that causes a blood clot to form and block…
Q: expalin the therapeutic uses of atropine and mepyramine.
A: Atropine is an alkaloid,which is chiefly obtained from Atropa belladonna,It is a member of…
Q: Which variables are used when calculating the encephalization quotient? a. absolute brain size b.…
A: Encephalization quotient (EQ) is a relative brain size measure that is defined as the ratio between…
Q: ㅇㅁㅁ ㅇㅁㅁ 미이 e pedigree shown, indicate whether each of the following inheritance patterns ssible by…
A: Mutation in any of the autosomes or sex chromosomes give rise to different types of inheritance…
Q: efine hormone. Name the hormone secreted by thyroid gland. Write its function. Why is it advised to…
A: In the body, hormones act as messengers. Endocrine glands release these substances. In order to keep…
Q: All mutations that abolish function of the Rho termination protein in E. coli are conditional…
A: Conditional mutations are those that prevent the Rho termination protein from functioning in E.…
Q: The ABO Blood Group System has one genetic locus that exhibits three (3) alleles: IA, IB, and i and…
A: Note: Since the question contains multiple subparts the first three have been solved for you. Please…
Q: each statement below indicate whether it is true or false. A. Assume that a species has a diploid…
A: These statements are simply from genetic and molecular biology. Aneuploid is simply change I'm…
Q: You answered this question like this??? I can’t read the answers , all answers are cut-out please…
A: Mechanisms of reproductive isolation are a collection of behavioural patterns, physiological…
Q: Alex is an active senior in high school who arrives for his appointment at 3:30 p.m. to see the…
A: Herpesvirus is a virus that causes infections in humans. These viruses are typically spread through…
Q: Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which…
A: DNA replication occurs prior to cell division and gets the cell ready for mitosis and meiosis.…
Q: A culture consisting of 100 litres of nutrient medium containing 12 g l-1 of growth limiting…
A: Biomass is organic matter that has been recently living or that is capable of decomposing to release…
Q: Which processes of evolution apply to the development of the Neandertals? Genetic drift Natrural…
A: Neanderthals These are extinct species who lived in Eurasia about 40,000 years ago. These are…
Q: Determine the possible explanation about generating the new kind of antibiotic for the treatment of…
A: Most people infected with toxigenic V. cholerae O1 have asymptomatic illnesses or self-limited…
Q: Regarding the analysis of single marker STR results used in forensic science. Tick all the correct…
A: Short Tandem Repeats (STR) are the specific location in chromosomes used for forensic analysis. In…
Q: . BMI (Body mass index) is the ratio mass in kilograms to the square of height in kilograms Between…
A: Introduction : Body Mass Index is the official name of BMI. It is a measurement technique that…
Q: please reflect on the three major subject areas 1. Evolution - including evolutionary processes,…
A: 1 evolution--Evolution is a change in the genetic composition of a population over successive…
Q: give a detail explaiantion of what hisamine and acetycholine is. Give fuctions and mehcnaims. the…
A: HIstamine and acetycholine are essentially signaling molecules. Endocrine signaling involves the…
Q: whats the difference between a chromosome, a chromatin, and a chromatid?
A: DNA is genetic material in living organisms that is composed of two polynucleotide stands. It…
Q: These are two paper the question start from the table.
A: Osmosis is the process of movement of water from the high-water potential to low water potential…
Q: ㅇㅁ ㅁㅁ 이미 ㅇㅇㅇ 움 In the pedigree shown, indicate whether each of the following inheritance patterns is…
A: The given pedigree has the following features: i) skips generation: affected children have both…
Q: Which of the following is the concentration of hemoglobin-bound oxygen in the blood when the heme is…
A: Hemoglobin is a protein in the blood that carries oxygen. It is important because it helps to…
Q: Which patients are most suitable for classical psychoanalysis?
A: Introduction Psychoanalysis is a claim to fame in brain science. It's not the same as different…
Q: What characteristics in a human pedigree suggest a mitochondrial location for a mutation affecting…
A: A human pedigree includes the family history of an individual, listing the parents, grandparents,…
Q: Which of the following statements is correct about the tropism of metastases
A: How cancer spread through metastasis from one part of the body to other? Which of the given…
Q: 11 MULTIPLE CHOICE QUESTION If proteins are not the right shape
A: 3- they usually won't work properly If proteins are not the right shape they usually won't work…
Q: All of the following proteins function during nucleotide excision repair, EXCEPT: A. DNA pol B. Uvr…
A: INTRODUCTION • Nucleotide excision repair (NER) is a particularly important excision mechanism that…
Q: Which one is important for pregnancy women during 1st trimester folate or iron or calcium or protein
A: The time from conception to birthing is referred to as a "pregnancy." It is a condition in which a…
Q: For each statement below indicate whether it is true or false: A. Strand discrimination during the…
A: A In eukaryotes, nicks (single-stranded breaks) that are unique to recently manufactured DNA are…
Q: What are the adult derivatives of the pharyngeal pouches? 2. What is the role of the allantoic…
A: The first pharyngeal pouch lies between arches one and two. The second pharyngeal pouch sits between…
Q: Do both cardiac and smooth muscle have gap junctions?
A: Introduction Gap junctions are channels that bodily join adjoining cells, mediating the fast change…
Q: The following picture drawing represents co-translation in E. coli. Answer the questions below the…
A: The question is to analyse the picture and answer the questions accordingly. Let's move on to the…
Q: In general, what is known about the prevalence of Hepatitis C, and how it can be transmitted? 2.…
A: Answer 1. With around 2 to 3% of the world's population carrying the illness, HCV is growing more…
Q: 10. Compare and contrast fermentation to cellular respiration. Click and drag the following to the…
A: Cellular respiration is an important part of the biochemical process taking place in the living…
Q: In the mismatch repair pathway, DNA damage is recognized by
A: DNA mismatch repair pathway in short known as MMR. It recognizes and repairs base to base mismatch,…
Q: Two true-breeding varieties of maize, one 11 cm high and the other 47 cm high were crossed and the…
A: Hello, thank you for the question. As you have posted a question with multiple subparts and all of…
Q: Phospholipids are those lipids that make up the cell membranes of most living things. They are…
A: Phospholipids: Phospholipids are a subclass of lipids that have two hydrophobic "tails" made of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNAA certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'
- In this sequence there are two introns and three exons. Exon 1 has 3 amino acids, exon 2 has 4 amino acids and exon 3 has 3 amino acids. Remember start and stop codons! Highlight the introns and number the exons. Show the start codon and stop codon and highlight and number the exons. Remember all introns start with GT and end with AG. 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' (a) How many base pairs are in intron 1 and intron 2?Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion SubstitutionUsing a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the table below. DNA triplet mRNA codon tRNA anticodon Amino Acid AAG GGC CAG UUA AAA GTA CUC ACA TAT AGC AUU CCA GGC
- Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the first AUG (start codon) in the sequence, starting from the mRNA 5’ end. When writing the amino acids that are found in the protein, you may use the single-letter code, three-letter code, or full amino acid names.he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…
- An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First PositionOn the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5’cap is indicated by (5’). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5’)CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA(3’) In a previous round of replication, DNA polymerase made a mistake and added a C on what is now the DNA template strand. In the space on the mRNA sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5’)CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3’