Considering that regulation most often occurs at irreversible steps in a biochemical pathway, which of the following pairs of enzymes are inhibited by both ATP and NADH?
Q: Find 3 reactions that facilitate the synthesis of oxaloacetate
A: The tricarboxylic acid cycle (TCA) is the metabolic pathway that generates NADH and FADH2 for…
Q: Draw the steps involved in the catabolism of thymine into malonyl-CoA. Include the names and…
A: Nucleic acids are composed of nucleotides, and nucleotides are composed of a pentose sugar,…
Q: The total degradation of a fatty acid with an odd number of carbons yields acetyl-CoA and another…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: What is qualitative analysis of lipids? How important qualitative analysis of lipids in the field of…
A: Lipids are one of the 4 major groups of biomacromolecules. Lipids are a set of biomacromolecules…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: 4. Peculiarities of hormonal regulation of glycogen metabolism in muscles and liver.
A: The glycogen synthesis mainly occurs in the muscle, and liver, using glucose-6-phosphate. The…
Q: A bag of Uncle John's potato chips contains 16 servings. What is the MAXIMUM amount of trans fat…
A: In nutrition, fat is an ester of fatty acids. Fat can be saturated or unsaturated. It can be further…
Q: With regards to hemoglobin-oxygen binding, CO2 is a [Select] modulator and 2,3-bisphosphoglycerate…
A: Positive allosteric modulators of haemoglobin -oxygen binding are the agents that stabilise R state…
Q: The inhibitor X prevents coenzyme Q (Q) from participating in electron transfer in the electron…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: Could you help with part d? Create a speciation diagram for histidine by plotting Xi vs pH from pH =…
A: His is a basic amino acids with pKa value of its side chain ~6, amine and carboxyl groups pKa values…
Q: what is the mechanism by organophospahtes inbibit enymes?
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: ----------------------the simplest lipids but they may be a part of or a source of many complex…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: 1 the concentration of the enzyme competition inhibitor was 1×10-3M. If 1 µmol of the inhibitor is…
A: The inhibitor is a competitive inhibitor, as can be seen from the table. The activity of enzymes…
Q: BIOC 385 Biochemistry of Protein Synthesis Q11.4: Considering that binding of the correct tRNA to…
A: Translation is the process of protein synthesis. It occurs in the cytoplasm. Ribosomes have peptidyl…
Q: Glycogen synthase in the liver is a target for phosphorylation by two protein kinases. What are…
A: Glycogen is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: In the following structure, the carbon labeled [Select] carbon, the carbon labeled [Select] is…
A: Monosaccharides are the simplest units of sugars. All monosaccharides are either aldoses or ketoses.…
Q: If the range of the graph in the first part of the question is supposed to be between 5 and 10,…
A: Changes in pH affect the ionisation of active site residues of an enzyme and alters the rate of…
Q: a) L-fucose is also known as 6-deoxy-L-galactose. Note that D-galactose is a C-4 epimer of…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: An unknown sample was tested if there is a presence of lipid, after the test it shows that it is…
A: These are the various preliminary and qualitative tests to estimate the presence and nature of…
Q: 1) Perform the necessary calculations and fill in the values in the table below (be sure to include…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: What are the Essential and Non-Essential Amino Acids? Describe each.
A: An amino acid is an organic compound that contains both an amino (-NH2) and carboxylic acid (-COOH)…
Q: Show the structure of each intermediate in the conversion of b-hydroxybutyryl-ACP to butyryl-ACP by…
A: De novo fatty acid synthesis is also called as Lynen's spiral is a set of reactions catalysed by a…
Q: Pathological Constituents of Urine C3. What are ketone bodies? What conditions (or diseases) lead…
A: Urine often contains water as well as contaminants such as urea, uric acid, ions, and creatinine.…
Q: What is true about lipids? A. They are polar and therefore soluble in polar solvents B They are…
A: The four classes of biological macromolecules are nucleic acids, proteins, lipids and…
Q: When an inhibitor blocks a step in electron transport, all of the following are true except that Oa.…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: This is the ATP accounting question. You are limited to the carbon in the following molecules:…
A: After glucose enters the cell, there are two possible fates it can undergo: enter glycolysis,…
Q: A patient on dapsone begin to experience dizziness and vertigo 3 days after taking his medication.…
A: Cyanotic defects: Cyanosis is a condition caused by cyanotic defects, in which the blood pumped to…
Q: What is the isoelectric point of the following peptide molecule?…
A: The pH at which a specific molecule carries no net electrical charge is known as the isoelectric…
Q: Suppose researchers studied the first chromosome of a new species and mapped three genes of…
A: The frequency of recombination is a measure of genetic linkage that is used to create a genetic…
Q: After the first step in the metabolism of amino acids, which of the following statements are true?…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: Name the components of products used in treating diarrhea and give the functions of each.
A: The term "gastrointestinal agents" refers to a broad category of medications used to treat…
Q: Describe two reasons why the reaction glutamine synthetase performs is important to the body.
A: Cells can accumulate nitrogen in the form of ammonia from amino acid degradation, photorespiration…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Enzymes are classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases…
Q: A pentapeptide has the abbreviation "GREAT". Draw the peptide and give its systematic name.
A: Peptides are short sequences of amino acids. Amino acids in a peptide are joined together through…
Q: CH2OH 바 조 он г 어 H CH2OH ㅇ 애 1 에 Beta-Derunopyranose KH H+ H2M осH2он 애 애 애 alpha- D- erunopyrunose
A: Alpha and beta forms of monosaccharide sugars are called anomers. The two forms are isomers and…
Q: The proton gradient across the inner mitochondrial membrane is produced.... by passing electrons to…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: Consider a membrane that has a very high content of phosphatidic acid on the inner leaflet of the…
A: Introduction Proteins are made up of amino acids. Protein plays various function in our body. Two…
Q: Using the results of linear regression analysis (log(MW, kDa) vs Rr) from the protein standards,…
A: Given that the linear regression analysis data of a plot of Log MW (in kDa) vs Rf is given as:…
Q: 19) Why do enzymes have compact structures? (If enzymes weren't globular, then where would the…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: How does ATP regulate the activity of PFK-1? ATP binds to PFK-1 at the catalytic site as a…
A: The enzyme phosphofructokinase 1 (PFK-1) catalyzes the following reaction: Fructose 6-P + ATP –>…
Q: Why stachyose can be used as prebiotic??how is the chemical structure of stachyose affect bacteria?
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: 3. Enzyme specificity. To determine the specificity of substrate binding for a particular…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Draw structure of Cytosine, Thymine and Uracil and describe the difference in the structure?
A: Nucleotides vs nucleosides Nucleosides are pentose sugar(ribose in the case of RNA and deoxyribose…
Q: Identify two (2) functions of lipids in the body. Explain each function in 2 sentences.
A: Lipids are a very important class of biological molecule. Lipids are a broader class of molecule…
Q: 5. Which of the following is true about myoglobin and/or hemoglobin? O (a) The iron in Hb is in the…
A: Both hemoglobin & myoglobin are globular proteins. Our red blood cells (RBCs) are composed of…
Q: what is does the induced -fit model account for? 2 why are most enzyme inactive at higher…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: The first step in the catabolism of most amino acids is which of the following? Transfer of alpha…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: Next exam will be on carbohydrates, protein equencing and enzymes iochemistry roblem Assignment…
A: Emil Fischer invented the Fischer projection, a method of representing the three-dimensional…
Q: Name the primary sources of ATP for: a. Immediate energy for a few seconds b. Energy extending to…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP: the energy…
Q6
Step by step
Solved in 2 steps
- The Effect of lodoacetic Acid on the Glyceraldehyde-3-P Dehydrogenase Reaction (Integrates with Chapters 4 and 14.) How might iodoacetic acid affect the glyceraldehydes-3-phosphate dehydrogenase reaction in glycolysis? Justify your answer.Ethanol as a Source of Metabolic Energy (Integrates with Chapters 19 and 20.) Acetate produced in ethanol metabolism can be transformed into acetyl-COA by the acetyl thiokinase reaction: Acetate+ATP+CoASHacetyleCoA+AMP+PPiAcetyle-CoA then can enter the citric acid cycle and undergo oxidation to 2 CO2by this route, assuming oxidative phosphorylation is part of the process? (Assume all reactions prior to acetyl-CoA entering the citric acid cycle occur outside the mitochondrion). Per carbon atom, which is a better metabolic fuel, ethanol or glucose? That is, how many ATP equivalents per carbon atom are generated by combustion of glucose versus ethanol to CO2?Asap
- Which reaction below in the glycolytic pathway has a highly unfavorable delta Gº' but a favorable delta G under physiological conditions? 1,3-Bisphosphoglycerate + ADP3-Phosphoglycerate + ATP O2-phosphoglyerate → phosphoenolpyruvate Ofructose-1,6-bisphosphate dihydroxyacetone phosphate + glyceraldehyde-3-phosphate Ofructose-6-phosphate → fructose-1,6-bisphosphateWhat is the function of glyceraldehyde 3-phosphate dehydrogenase? catalyzes the transfer of a phosphoryl group from ATP to an acceptor oxidation of the alcohol to an aldehyde dehydration and dephosphorylation of GAP hydrolysis of GAP oxidation by NAD+ and formation of acyl-phosphateWhich citric acid cycle enzyme utilizes a similar reaction mechanism to pyruvate dehydrogenase? O Malate dehydrogenase Isocitrate dehydrogenase O Alpha-ketoglutarate dehydrogenase Succinate dehydrogenase
- Which of the following is true about comparing the α-ketoglutarate dehydrogenase complex and the pyruvate dehydrogenase complex? Group of answer choices They catalyze reactions that produce the exact same set of products They are both dehydrogenase complexes, but have very different structures They both catalyze reactions that oxidize NADH to NAD+ They both use the same E3 enzyme component Which of the following best describes stage 2 of the citric acid cycle? Group of answer choices ATP production by the electron transport chain production of acetyl CoA regeneration of oxaloacetate release of 2 carbons as carbon dioxideThis is the ATP accounting question. You are limited to the carbon in the following molecules: One xylulose 5-phosphate, One glyceraldehyde 3-phosphate, One sedoheptulose 7-phosphate, 1 Oxaloacetate, and 3 carbon dioxide A) Disregard regulation completely regarding pathway activity, using only the enzymes of glycolysis, pentose phosphate pathway, and citric acid cycle, what is the maximum ATP one can generate with these molecules? B) Disregard regulation completely regarding pathway activity, using only the enzymes of glycolysis, Calvin- Benson-Bassham cycle, and citric acid cycle, what is the maximum ATP one can generate with these molecules (in this instance only, you also are given 3 ATP and note that you do NOT need to regenerate substrates for rubisco once you get through this enzyme).Which of the following statements inaccurately describes glutamate dehydrogenase? Glutamate dehydrogenase uses either NAD+ or NADP+ in a redox reaction Glutamate dehydrogenase catalyzes an oxidative deamination reaction Glutamate dehydrogenase equilibrium lies with the reductive amination of glutamate Glutamate dehydrogenase utilizes hydrolysis to release ammonium from an imine intermediate
- Compare and contrast Pyruvate Dehydrogenase with a-ketoglutarate dehydrogenaseOutline the mechanisms of both enzymes. Discuss the functions of the coenzymes. List the similarities and the differences between the 2 enzymes. Both are very large membrane bound complexes. What are the advantages of this strategy?How detailed is the enzyme structure known below(It's Pyruvate Dehydrogenase )? What insight(s) does this structural detail give you about the enzyme mechanism.The glyceraldehyde-3-phosphate-deshydrogenase glyceraldehyde-3-phosphate in 1,3-bisphosphoglycerate. catalyses the catalyses -CH₂ -CHOH—CHO + Pi + NAD* the oxidation of CH₂ CHOH-COQ + H* + NADH When the enzyme is incubated with iodoacetate, it is observed that glyceraldehyde-3- phosphate still binds to the modified enzyme, but it is not oxidized. What conclusion can be drawn from this experiment? Data: iodoacetate ICH₂COO is an alkylating reagent that react with free sulfhydryl groups (-SH) to form (-S-CH₂COO).Page > of 6 ZOOM + TCA cycle, oxidative phosphorylation, metabolic regulation TCA cycle (Ch. 16) 1. The citric acid cycle has eight enzymes: citrate synthase, aconitase, isocitrate dehydrogenase, a-ketoglutarate dehydrogenase, succinyl-CoA synthetase, succinate dehydrogenase, fumarase, and malate dehydrogenase. (a) Write a balanced equation for the reaction catalyzed by each enzyme. (b) Name the cofactor(s) required by each enzyme reaction. (c) For each enzyme determine which of the following describes the type of reaction(s) catalyzed: condensation (carbon–carbon bond formation); dehydration (loss of water); hydration (addition of water); decarboxylation (loss of CO2); oxidation-reduction; substrate-level phosphorylation; isomerization. (d) Write a balanced net equation for the catabolism of acetyl-CoA to CO2.