Create a shell script that lists all the files in the present working directory in long format name this file listMyFiles.sh. Write a c program that uses the system () function and uses it to run listMyFiles.sh
Q: Write a shell script to implement the following menu in an infinite loop. Every new appearance of…
A: An infinite loop is an endless looping construct that does not terminate the loop and executes the…
Q: Write a Shell program in C that can handle pushd, popd , and dirs commands supported by many shell…
A: SHELL PROGRAM:
Q: 1. In indexed file allocation method, assuming that the block can only store 8 pointers as shown in…
A: File Allocation Methods: An allocation method is to tell how the disk blocks are allocated for a…
Q: Python 3.8.5 Shell File Edit Shell Debug Options Window Help Python 3.8.5 (tags/v3.8.5:580fbb0, Jul…
A: In This Program You are importing a package with is Not installed. Firstly Run Command on the Shell…
Q: PLEASE INCLUDE PIPING, ANSWERS WITHOUT IT ARE NOT VERY HELPFUL SINCE THEY DONT INCLUDE IT**
A: myshell.c: //header file section #include <stdio.h> #include <stdlib.h> #include…
Q: Suppose you are working with R and you find your current working directory by running the following:…
A: The solution for the above given question is given below:
Q: .Create a directory called dir1
A: ls command was surely one of the first commands you have executed.Frequently used options : -l :…
Q: earn to d
A: The provided C code is done as per your requirements. "Screenshot of the program code" for better…
Q: I WANT A CODE IN C++. PLEASE DO NOT COPY AND PASTE FROM THE ALREADY PRESENT AWNSER!!! i have…
A: PROGRAM CODE: #include <stdio.h> #include <unistd.h> #include <string.h>…
Q: Assume a system is able to support up to 2,000 users. Suggest a UNIX protection scheme which allows…
A: The access for a particular file could be managed by the administrator responsible for system…
Q: File allocation method: LINKED LIST Total blocks: 32 File allocation start at block: 8 File…
A: As in the problem only "main" function was to be completed, it is assumed that the student has…
Q: Assignment #3: Unix shell with redirects and pipes The purpose of this assignment is to learn to…
A: Solution :: The provided C code is done as per your requirements. "Screenshot of the program code"…
Q: Write a shell script to find the average length of filenames of c source files in a given directory.…
A: Algorithm: Start Initialize sum to 0 and count to 0 Read the directory name Change the directory to…
Q: 5. Write the UNIX commands to: a. Create a shell script named LL that lists your directory in a long…
A:
Q: ou work for a small company that keeps the following information about its clients: • first name •…
A: def get_parts(str1): lst = str1.split(',') #Split a string into a list based on ','…
Q: Performing the following tasks will help you become more familiar withthe various tools for…
A:
Q: Which one is not false? Unix users can do more than one task simultaneously. In Unix partitions are…
A: --In unix partitions are sometimes known as slices not divisions. So option 2 is false. --In Unix…
Q: Question 1 Write a C program which takes two arguments from command line: one filename and one…
A: #include <stdio.h> #include <stdlib.h> #include <unistd.h> #include…
Q: 1.Which of the following is true about a character device? * a)Operating on a character device does…
A: The answer is
Q: Bash Shell Script Programming Assignment Question 1. Create a shell script file called q1.sh Write a…
A: Answer is given below. Q1) To check if the given 2 strings are equal. #!/bin/bash read s1 #read…
Q: Answer the following questions.…
A: 1) Map files (source maps) are available for target code (css and JavaScript). And they are mainly…
Q: Write a simple version of the Linux find program: find all the files in a directory tree whose name…
A: command ls | grep 'string'
Q: Suppose you have a C program whose main function is in main.c and has other functions in the files…
A: How would you modify the above commands to link a library called process1 stored in the standard…
Q: Question 1 4) Listen what is the output of the following code: O function (name, pos = -1L, envir =…
A: According to the Bartelby guidelines we are suppose to answer only 3 multiple choose question at a…
Q: Write a program to ask customer what are the bucket name and folder name in AWS S3, and which local…
A: # program using python import boto3 # import boto3 library import os import sys # create connection…
Q: Match the following questions with their best answers. v Which terminal program performs a…
A: cd command is used to change directory from current path. ls is used to list out the files present…
Q: Assume a system has a capacity of 2,000 users. Propose a UNIX security mechanism that enables 1,990…
A: Start: The administrator in charge of system management could control who has access to a specific…
Q: Write a shell script that accepts a filename as its argument. The named file is assumed to be a text…
A: The script should save the original content to a file with the original name with ".orig" appended.…
Q: Overview A shell interface gives the user a prompt, after which the next command is entered. The…
A: Actually, UNIX is a multitasking. multiprogramming operating system.
Q: write c program? plz single c file write a program that will copy all files under the given folder…
A: write a program that will copy all files under the given folder to another one. In order to be able…
Q: Modify rnfile such that it will keep a copy of the old existing file (if available) before the…
A: Given: Modify rnfile such that it will keep a copy of the old existing file (if available) before…
Q: Please help me answer these questions: What are the four main/common attributes of a file. How can…
A: A file can be "free formed", indexed or structured collection of related bytes having meaning only…
Q: Write a shell program to perform the following task a. Display the present working directory. b.…
A: ANS:) Using the following program we can perform the tasks in the Unix shell. pwd command prints…
Q: Prajwal wants to transfer all his highly confidential C program files, C++ program files and java…
A: in this question we want to do following 1. copy c programming files to the directory c_codes…
Q: Question 5 a) how would you compile an assembly file listMyFiles.asm into an object file…
A: You can use gcc for these purposes a) To compile the asm code, use the following command gcc -c…
Q: The purpose of this assignment is to learn to develop multi-process programs. You are expected to…
A: Assignment 3 in C: Unix shell with redirects and pipes The purpose of this assignment is to learn to…
Q: The Problem: Read the name of a C file with full path, move it to a newly created folder named “c”…
A: Whenever you want to work with a file, the first step is to create a file. A file is nothing but…
Q: (a) Write a shell script that takes names of the directory as the command line argument and produces…
A: Shell script to find the largest number from the given three command line arguments: read a b cif…
Q: You are developing a system that stores its data on a UNIX file system. You anticipate that you will…
A: Answer: Adapter design pattern is used as interface for existing componentss. Facade design pattern…
Q: Q-2: Write a shell script which can read all the lines from a file, and this should able to delete…
A: use vi bash.sh echo enter filename read f awk ‘NR % 2 == 0’ $f
Q: pecial usage regarding file permission. can you modify the permission by using OCTAL number?
A: Q. OCTAL numbers have special usage regarding file permission. can you modify the permission by…
Q: Consider the following Unix commands and identifies the output of the commands. cp -i file1 file2…
A: The correct answer is given below with an explanation
Q: The following sequence of operations were performed on the file "src/CreateMe.java". What state is…
A: Task : Choose the correct answer for given question.
Q: In UNIX/Linux, what would the octal notation be for a file with the following, permissions. • Owner…
A: permissions are for files. permissions are given to the different users and according to the…
Q: If you are working block of that file and to be high are large file and you close that file, would…
A: Part 1 The workload would be high on AFS.
Q: 2. Exploring envp: a. Modify showEnvp.c so it reports envp addresses in the same style as showArgs2…
A: ANSWER:
Question 1
a) Explain the difference between ls -l > mylisting.txt and ls -l >> mylisting.txt
b) Create a shell script that lists all the files in the present working directory in
long format name this file listMyFiles.sh. Write a c
system () function and uses it to run listMyFiles.sh
c) Create a daemon in C in the Unix environment, your daemon must create a
text file called aitDaemonLog.txt and populate it with 1000 lines of a string
each line must be written after 10 seconds, the string must end with the count
of the string;
Step by step
Solved in 4 steps with 2 images
- In an executable object file that is in executable and linkable format (ELF), which section defines the addresses of the stack and the heap? A. The data section B. The .text section C. These addresses are not defined in the executable object file. Instead, they are assigned by the operating system when the program is loaded in to me D. These addresses are not defined in the executable object file. Instead, they are assigned by the user when the program is running in memory. Reset Selection1.What is the primary goal in using a scripting language for programming work? 1.Write a shell program that counts the number of files in a given directory. Thedirectory should be specified as a command line argument. The program doesnot need to count files recursively in subdirectories; instead, it should not count subdirectories at all.Assignment #3: Unix shell with redirects and pipes The purpose of this assignment is to learn to develop multi-process programs. You are expected to extend the myshell.c program and add pipelines and I/O redirections. In particular, your shell program should recognize the following: > - Redirect standard output from a command to a file. Note: if the file already exists, it will be erased and overwritten without warning. For example, COP4338$ ls > 1COP4338$ sort myshell.c > 2 Note that you're not supposed to implement the Unix commands (ls, sort, ...). You do need to implement the shell that invoke these commands and you need to "wire" up the standard input and output so that they "chain" up as expected. >> - Append standard output from a command to a file if the file exists; if the file does not exist, create one. For example, COP4338$ sort myshell.c >> 1COP4338$ echo "Add A Line" >> 1 < - Redirect the standard input to be from a file, rather than the…
- Write a Shell program in C that can handle pushd, popd , and dirs commands supported by many shell programs including bash, tcsh and zsh. examples/how it works: The user enters pushd + [directory] The user enters popd The user enters dirsQuestion 2 Write a C program which creates 5 threads for storing numbers sequentally from 0 to 50.000 in a file named "numbers.dat". Each thread must write 10.000 numbers (e.g. first thread writes 0 - 9.999, second thread writes 10.000 – 19.999, etc).Need help to implement networking in python Server.py Load data from file This option will ask the user for a fully qualified path and will load a JSON file containing the information for users and pending messages. The format of the JSON file will be defined based on your implementation and it will the same used to save the data into file (menu option #4). Functionalities the server must provide: 1) User Sign Up: adds a user identified by a phone number to the system. a) Protocol: USR|username|password|display_name b) Response: 0|OK for success. 1| for an error. c) The server should validate that the username does not exist 2) User Sign In: verify user credentials a) Protocol: LOG|username|password b) Response: i) 0|OK → the credentials are correct. ii) 1|Invalid Credentials iii) 2|Already Logged In → in case that the user is logged in from another client. c) This will help the server knowing which user is connected. d) The server should keep a list of connected clients, which should…
- C++ PLEASE!! Working on a project that is about word count with MapReduce, need a file manager class to take care of reading all txt file from a directory with giving path. The file manager class need to open the directory with the giving path which the user will input, then open the path and open all the txt files in that directory and break the text into single line and pass it to another class to do mapping. Please help with the file manager class!! Thank you!!Please write a c++ program that will take in a file, a number_of_bytes and number_of_threads. So it will take in 3 arguments in the command line. mmap the number_of_bytes of the given file into memory. The program will mmap 100 Megabyte of file into memory and use 4 threads to examine the bytes. The main will not participate in the computation, but will create the specified number of threads, and wait for them to complete the computation, and the main will then print the answer. At most 8 threads will be specified to be created. Each file will contain a long string of letters like DNA, i.e. a,c,g,t The program should determine how many 20-character substrings contain more than 11 a's. For example, in this string there are characters matches: tattataaagtagaaatataactgaaggttcagccgctggattataaagtagaaatataaaaagtagaaatataactgaa The program should output: total matches number # number is replaced by the correct numberAssignment #3: Unix shell with redirects and pipes OCELOT UNIX OS **PLEASE INCLUDE PIPING, ANSWERS WITHOUT IT ARE NOT VERY HELPFUL SINCE THEY DONT INCLUDE IT** The purpose of this assignment is to learn to develop multi-process programs. You are expected to extend the myshell.c program and add pipelines and I/O redirections. In particular, your shell program should recognize the following: > - Redirect standard output from a command to a file. Note: if the file already exists, it will be erased and overwritten without warning. For example, COP4338$ ls > 1COP4338$ sort myshell.c > 2 Note that you're not supposed to implement the Unix commands (ls, sort, ...). You do need to implement the shell that invoke these commands and you need to "wire" up the standard input and output so that they "chain" up as expected. >> - Append standard output from a command to a file if the file exists; if the file does not exist, create one. For example, COP4338$ sort myshell.c >>…
- Computer Science Write a C/C++ program, call it findExt, to find all files in a directory hierarchy, whose extensions are in the extension list provided as arguments to the program. Your program should print the whole pathnames of the found files. Synopsis: findExt <extension-list> [-t target-directory] When target-directory is missing, the working directory (./) will be the target directory Some sample runs: $ findExt txt pdf That is, find all files whose extensions are either txt or pdf in the directory hierarchy ./ $ findExt jpg -t $HOME //target directory is home directory That is, find all files whose extensions is jpg in the directory hierarchy $HOME Requirement: - You must use the system call nftw() that allows you to walk across a file tree. This system call will do all the recursive walk and each time it visits a file or a directory, it will call your own function (a function that you pass as a parameter).92. In external hashing for files of disk, the pointers which contain record position and block address within the block are classified as a. position pointers b. address pointers c. block pointers d. record pointersNeed Help with C++ coding, and please explain the first step in detail. Write a program in C++ that performs three functions using threads on the attached text file called long_text.txt 1. Write your code in a such way that you can show in terms of time that using threads does not keep you blocked i.e., the main thread gets free once all threads start. a.This means that your program will run the three functions without threading and then with threading. 2. Functions to implement are: a. word_count() → will count the number of words in the text file b. sentence_count() → will count the number of sentences in the text file c. find_frequent_word() → finds the most frequently occurring word and number of times it occurred in the text