Determine the fraction of Vmax that would be obtained when the substrate concentration, [S], is 0.5 Km- Vmax fraction: 0.167 Incorrect
Q: 1. The enzyme you are studying uses the substrate pictured at right. An inhibitor box in the freezer…
A: Enzyme inhibition is when a inhibitor bind to the enzyme at the active site or another site, which…
Q: 3. 1,3-bisphosphglycerate has a high energy bond that can be used to phosphorylate ADP to make ATP…
A: Delta G or the standard free energy of a reaction indicates the tendency of a reaction to move…
Q: The drug troglitazone was used to treat diabetes but was withdrawn from the market when patients who…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Prostaglandins are a class of cicosanoids, fatty acid derivatives with a variety of extremely potent…
A: Vmax and Km of an enzyme in the presence and absence of inhibitor can be determined by using a…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: A sphingosine , stearic acid and D-galactose would condense to form a sphingolipid. Sphingolipids…
Q: In an uncatalyzed reaction, KF(uncatalyzed) = 2.5 X 10-8/s and Keq is 5 X 10². For the same reaction…
A: Consider the reversible reaction given below. A ⇄kRkF B Here , kF is the rate constant for the…
Q: An analysis is performed to determine the proportions of each of the four nucleotide bases in the…
A: The genetic material in the cells of most organisms is DNA or deoxyribonucleic acid. DNA is…
Q: The following peptides were separated using ion-exchange chromatography based on the use of an anion…
A: Ion exchange chromatography separates fractions based on net charge. There are two types of ion…
Q: Sucrose + H2O (negative control): Colorless to brown solution: Blue solution Conclusion for Iodine…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Explain why quaternary structure is necessary for cooperativity and allosteric regulation. Use…
A: The proteins with two or more polypeptides are called oligomeric proteins and possess a quaternary…
Q: is lapoamide involved in oxidation reduction..
A: INTRODUCTION : First of all there is no such biochemical name like Lapoamide(its incorrect) The…
Q: As the leading scientist in a biomedical science laboratory, it is up to you to give advice to your…
A: Polymerase chain reaction or PCR s a method to obtained large number of copies of a target DNA…
Q: At pH 5, what is the net charge of the pentapeptide Val-Glu-Cys-Ser-Lys? O-1 O 0 O +1 O +2
A: The amino acids contain ionizable groups. The ionic form of theses ionizable groups depends on the…
Q: 2. The Km of a particular enzyme is 2.0 x 105 M. If the initial velocity (Vo) is 0.16 mmol/min for…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Protein folding can be described as an equilbrium between an unfolded state (U) and the folded…
A: Change in Standard Gibbs free energy (∆G0') is the change in Gibbs free energy (∆G) at equilibrium.…
Q: What effect is seen on a Lineweaver-Burke graph when a non-competitive inhibitor is added to an…
A: The enzymes can be regulated in presence of competitive, uncompetitive and noncompetitive…
Q: Which of the following is not a catabolic fate for pyruvate formed in glycolysis? fermentation to…
A: Pyruvate is the end-product of glycolysis. It is ultimately transported into the mitochondria and…
Q: phosphate. Contrast the properties of hexokinases I and IV with respect to oligomeric structure,…
A: Hexokinase is an enzyme that has the ability to transfer inorganic phosphate group from ATP to the…
Q: Mabelle used the pET vector system to express her prokaryotic amylase enzyme. She added IPTG into…
A: In expression and purification of protein from bacterial system, the following steps are performed:…
Q: (Multiple coenzymes on the left may match to the same reaction on the right. Some reactions on the…
A: Co enzymes are the molecules that help in accelerating the reaction rate or helping the enzyme to…
Q: Kt of glucose for GLUT1=3 mM, GLUT2=17 mM, GLUT 3=1.3 mM, and GLUT11=0.3 mM. Sketch a graph with…
A: The equation that gives the rate of transport of molecule is similar to the rate equation of…
Q: From which biosynthetic pathway is eugenol derived? O A. mevalonic acid OB. shikimic acid O C. mixed…
A: Eugenol is an allylbenzene derivative that is extracted from the essential oils from cloves. It is a…
Q: Exergonic and endergonic biochemical reactions; the role of ATP and other macroergic substances in…
A: INTRODUCTION : ATP - Adenosine triphosphate, it is the main energy currency or units, which is…
Q: For the following scenarios, determine whether the molecules in the scenario are moving by simple…
A: Biological membranes are structures that surround the cell or organelles and act as barriers. An…
Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Glutamine is an amino acid that has -CH₂-CH₂-CO-NH₂ as its R group. The R group of the amino acid…
A: There are hundreds of different amino acids however only 20 different amino acids participate in…
Q: Shown below is a theoretical titration curve of histidine (amino acid). Use the provided titration…
A: Histidine is a basic amino acid with an alpha-carboxylic group, an alpha-amino group, and a…
Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting linoleic acid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: When a peptide bond forms, a(n)________ reacts with an amine to form a(n). O aldehyde; aldimine O…
A: Introduction: A chain of amino acids that are linked by peptide bonds to form a protein. Peptide…
Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…
A: Most enzymes are proteins and proteins are primarily made up of amino acids. Amino acids bond with…
Q: What is the hydrodynamic stress of bioreactors when there are cell cultures?
A: Bioreactors are vessels housing cell cultures , that provide optimum conditions for cell growth and…
Q: *The enzyme glucose oxidase isolated from the mold Penicillium notatum catalyzes the oxidation of…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: The K of an enzyme is 5.0 mM. Calculate the substrate concentration when this enzyme operates at…
A: Km is the substrate concentration when the reaction rate is half the maximal rate. Thus, high Km…
Q: Explain IN DETAIL the reactions and processes of alcoholic and lactic acid fermentation. Include…
A: The process of cellular respiration leads to catabolism of pyruvate after the glycolytic pathway.The…
Q: Mutual intermediates of catabolism of proteins, carbohydrates and lipids; their role in the…
A: Catabolism is the process of breaking down of complex compounds into simple molecules. The catabolic…
Q: Compare the principle behind DNA migration in an agarose gel electrophoresis from that of protein…
A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…
Q: Provide 5 differences of HDL and LDL and explain each biochemically.
A: "Lipoproteins," a class of proteins, carry cholesterol through into the blood. Two different…
Q: 1. What is the possible identity of the amino acid? [ Select] V 2. What is the isoelectric point of…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
Q: 14. Which of the following is a secondary amide? A. 요 B. NH₂ C. D.
A: Ans: INTRODUCTION The amide group is represented in structural formula by CONH2 .…
Q: Determine whether each of the statements describes amyloid beta (AB) in Alzheimer's disease (AD),…
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: Provide the principle of each test used to detect the following substances. 17. RNA: 18.…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: For paper chromatography, the obtained Rf value of an amino acid with uncharged nonpolar R group is…
A: Chromatography is performed to separate a mixture of closely related substances. Paper…
Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: At pH 3, the R-group of histidine is_______ and O protonated; neutral O protonated; positively…
A: Histidine (His or H) is an essential amino acids used in the biosynthesis of proteins. It contains…
Q: Draw the catalytic triad of a serine protease at the first tetrahedryl intermediate stage. Your…
A: Serine proteases cleaves peptide bonds of protein substrates. They are called serine proteases…
Q: In most enzymes, the required active site amino acids consists of only a few residues. Why is the…
A: Enzymes are proteins that function as biocatalysts and catalyse biochemical reactions.They have a…
Q: Draw his trp arg pro glu met ile | PH = 2 1b) How many possible structures are there for this? 1c)…
A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…
Q: he following is a coenzyme or cofactor involved in enzymatic reaction. identify the biochemical role…
A: A coenzyme is an organic non-protein compound that binds with an enzyme and assists in enzyme…
Its not 0.67, 0.167, or 0.25.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The turnover number for an enzyme is known to be 5000min-1. Given the following set of data, Substrate concentration(mM) 1, 2, 4, 6, 100, 1,000 Initial Rate(micromol/min) 167, 250, 334, 376, 498, 499 a) What is the Km of the enzyme for the substrate? (do this without using a calculator) b) What is the total amount of enzyme present in the assay?An enzyme catalyzes a reaction with a K of 7.50 mM and a Vmax of 4.15 mMs. Calculate the reaction velocity, o, for each substrate concentration. [S] = 1.75 mM MM-s-1 [S] = 7.50 mM [S] = 11.0 mM DO mM-s mM-sConsider the given data for an enzyme-catalyzed reaction. Determine the Vm, Km and the type of inhibition based on the given data below Substrate concentration, uM 30 50 100 300 900 slope y-intercept Complete the table below (include correct units). Experiment A Vm Km Experiment A (Initial velocity without inhibitor, uM-min) Type of Inhibition: 10.4 14.5 22.5 33.8 40.8 Experiment B (Initial velocity with inhibitor, uM-min) 5.1 7.3 13.3 25.7 37.2 Experiment B
- An enzyme catalysed reaction has a Km of 8 mM and a Vmax of 13 nM.s-1. Use the Michaelis-Menten equation to calculate the reaction velocity when the substrate concentration is 18 mM.Vmax and Km were calculated for enzyme substrate data. Results Y=0,0063x+0,3929 Km =62,4 mikromol/L Vm =159 mikromol/L.min But two additional data pairs were obtained at low concentrations and new graph equation Y=0,0063x+0,391 Recalculate Vmax and Km and compare and comment with previous results.when saturated with substrate, an enzyme has a maximum initial rate of 110mumoles of substrate converted to product per second. At a substrate concentration of 100mu M, the same enzyme converts substrate to product at a rate of 0.010mmoles/ sec. Assuming that Michaelis - Menten kinetics are followed, calculate the reaction rate when substrate concentration is 2x10^-3M.
- Vo 60 50 40 30 20 mm/sec 0100 0 O 0 0 50 100 150 200 250 300 Substrate (mM) Use the Michaelis-Menten plot to answer this question. What is the estimated value of Vmax of the enzyme catalyzed reaction (square data points)? (choose the one best answer) 10You are working on an enzyme that obeys standard Michaelis-Menten kinetics. What variable is the V, dependant on if the concentration of the substrate is substantially higher than the concentration of the enzyme? [S] [E] [ES] O [P] O not enough information providedIf 287.9 umol of enzyme X has a Vmax = 47.8 mmol/sec, what is the value of kcat %3D sec-1? Please report answer with 1 decimal place. Please do not report units. Your Answer: Answer units MacBook Air 888 F5 F4 F3 F2 %23 %24 %24
- You are working on an enzyme that obeys standard Michaelis-Menten kinetics. You have determined the Vmax to be 0.1 mol/sec and the Km to be 2.5 mM. What would the rate of the reaction be when the substrate concentration is 20 mM? 0.09 MS-1 O 0.133 Ms-1 O 0.18 Ms ¹ 9 Ms-1 O 0.018 Ms-1 0.2 MS-1Compound A is the substrate for two enzymes, El and E2, their reaction rates, r1 and r2,Determine the Km and rmax for both enzymes, with respect to the concentration of A. Which set of data is more likely to be for El and which for E2, and why? Concentration of 0.2 0.6 1.2 3 4 5 6 8 12 15 A (mM) Reaction rate (r.) (mmol/L'min) 3.33 4.29 4.62 4.76 4.84 4.88 4.9 4.92 4.94 4.95 4.96 4.97 Reaction rate (r,) (mmol/L*min) 0.09 0.23 0.38 0.5 0.6 0.67 0.71 0.75 0.8 0.82 0.86 0.80You will perform the protocol below for the calf intestinal alkaline phosphatase (CIP) provided. For each reaction, your final enzyme concentration should be 10 nM CIP. Note: Enzymes purchased are typically labelled with their “units of activity” (U), as this relates to how much enzyme is needed to catalyze a reaction. The 100 nM CIP provided has approximately 3 U/mL and was diluted 1 in 1,000 from a 500 U/mL purchased enzyme. 1) Create a table (similar to the one below) to help you determine and keep track of what to add to each of the cuvettes in which your reactions will be measured. The five different concentrations of PNPP should be: 25, 50, 100, 200, 300 μM. Each reaction will be in a final volume of 1 mL and contain 10 nM alkaline phosphatase. Concentrations of stock solutions: 1.0 mM PNPP, 100 nM calf intestinal phosphatase