Digestion of cellobiose in cows produces two glucose units which is then absorbed into the blood and distributed into the cells for energy production. One glucose unit is catabolized in the muscle cell while the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATP molecules are released? Show your detailed computation.
Q: A partial diploid in E. coli is created so that LacI is no longer expressed from the genome and is…
A: Partial diploid E.coli has both chromosomal DNA (i.e. genome) and plasmid DNA, but all the genes are…
Q: compound. (2 pts) 8: Migratory birds in the weeks preceding their long flights often consume a…
A: The objective of the question is to understand why migratory birds consume a fat-rich diet before…
Q: Predict the product(s) of the following reaction. H H NaOH, EtOH heat HO E + Z isomers A E + Z…
A: Approach to solving the question: Detailed explanation:In the first step, an enolate ion is formed…
Q: No need to upload any image just give me the answer with proper explanation.
A: The structure shown in the image is of a molecule that appears to be a synthetic opioid. Based on…
Q: 9. A) Please write down the names of the following protein folds. A B C B) Which one(s) is made of…
A: C) Haemoglobin the motif is coiled structure which facilitates binding of four polypeptide chains,…
Q: ALL POSSIBILE PRODUCTS
A: Crossed aldol condensation is a type of aldol condensation reaction where two different carbonyl…
Q: Derivatives of purines and pyrimidines make up the base component of nucleotides. Н HCG 6 N 5 7…
A: Deoxyribonucleic acid (DNA) is a molecule that is present in all known living things as well as many…
Q: Hemp oil contains eicosenoic acid (20:149) as its primary monounsaturated fatty acid. Let's consider…
A: Approach to solving the question: Detailed explanation:1.β-Oxidation Products and ATP Required for…
Q: Transcription factors are a specific type of nuclear proteins. How do transcription factors get…
A: Transcription factors are proteins that bind to the specific DNA sequences in or around the…
Q: 11. Treatment of disrupted erythrocyte membranes with a concentrated salt solution released an…
A: Hope it answer your questions. Let me know if you have any clarification. Thank you.
Q: A drawing of a cell in anaphase is provided. The cell contains 8 unreplicated chromosomes with…
A: Self explanatoryHope the answer was helpful. If any doubts feel free to ask for further…
Q: A gene encoding a miRNA was mutated so that it forms a perfect complement to its target mRNA. This…
A: MicroRNAs (miRNAs) are a class of small, non-coding RNAs that play a pivotal role in the regulation…
Q: enzymes do pol 6: Would replacing phosphate (PO4) with sulfate (SO4) in glycerophospholipid have any…
A: The question is asking about the potential effects of replacing the phosphate group (PO4) with a…
Q: A student performed an enzyme inhibition reaction to experimentally determine the inhibitor constant…
A: The Dixon plot is a graphical method used in enzyme kinetics to determine the inhibition constant of…
Q: The reaction shown below occurs in glycolysis. Which of the following is false about this reaction?…
A: Glycolysis is a catabolic pathway which breaks down glucose into two molecules of pyruvate that…
Q: Your colleague handed you a novel strain of coli that is purifying a protein with a 6xHisTag; they…
A: Detailed ExplainationCompetitive Metal Chelation:Dicarboxylic acids, such as citric acid, have…
Q: Draw a pathway diagram showing the involvement of Rubisco in the Calvin cycle andphotorespiration…
A: To address the question effectively, I'll provide a detailed response for each part: Pathway…
Q: 11. Below is a folding energy funnel describing folding energy landscape of a protein. The width of…
A: B) Folding Pathways:The protein has multiple folding pathways within the funnel. Imagine a funnel…
Q: using sample prep aka the protocol use it to fill in the tables
A: Explanation: Lysozyme (mL): The amount of lysozyme diluted and added to each conical tube. The…
Q: What is the major organic product obtained from the following sequence of reactions? 4 1 2 3 2. H3O+…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: Arrange the steps of performing the test to detect the presence of the glycoproteins indicating…
A: The objective of the question is to arrange the steps of performing the test to detect the presence…
Q: Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts…
A: The objective of the question is to identify an amino acid that could replace the Serine (Ser)…
Q: If the following polysaccharide were to attach to a protein, to which atom(s) in the carbohydrate…
A: A glycosidic bond is a type of covalent bond formed between the anomeric carbon of the carbohydrate…
Q: Absorbance A calibration curve for the absorbance of an unknown is shown below. What would be the…
A: A calibration curve is plotted to determine how the absorbance of a solution changes as per the…
Q: Which of the following statements accurately describes differences in beta oxidation vs fatty acid…
A: The objective of the question is to identify the accurate statements that describe the differences…
Q: Describe in detail the effect of loss or mutation of LAT & Blk of the following…
A: Let's delve deeper into the specific mechanisms affected by the loss or mutation of LAT and Blk in…
Q: (c) The tube and cylinder diagram to the right illus- trates schematically the potassium channel…
A: answers are given below.Explanation:c) the positioning of Tyr62 and Thr74 on the Alpha helix is…
Q: Tryphtophan is an essential amino acid that is used in the biosynthesis of proteins. Its molecular…
A: Amino acids are biomolecules that have a hydrogen atom, a carboxyl group, an amino group and a…
Q: The kinetic data in the following table were obtained for the reaction of carbon dioxide and water…
A: The substrate affinity of CO2 for carbonic anhydrase or Km is found to be 10 mM.Explanation:Step 1:…
Q: Transcription factors bind to: Question 20 options: DNA regions called…
A: Transcription factors bind to: DNA regions called cis-acting elementsExplanation:The question…
Q: Classify each of the amino acids below. Note for advanced students: none of these amino acids are…
A: Certainly! Amino acids, the building blocks of proteins, are typically classified by the properties…
Q: STEM Workplace Practices Q3
A: The objective of the question is to understand the purpose of release-testing in the context of…
Q: What is this TLC's Rf Value
A:
Q: Which statement is false? ○ Each chain of collagen adopts a right-handed helix ○ Disulfide linkages…
A: Step 1: The false statement is : Silk resists stretching because of its β conformation.…
Q: Draw the product AND propose a reasonable, detailed stepwise mechanism, using curved arrow notation…
A: here in first step in presence of base H+ ion is removed from alpha position of carbonyl carbon and…
Q: The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’…
A: Start and Stop Codons:In the genetic code, certain codons have specific roles. The codon "AUG"…
Q: 1.(a) ( ) Trace the course of [1,6-(C-14)-2,5-(C-13)]glucose that is first processed through…
A: Explanation of [1,6-(C-14)-2,5-(C-13)] glucose BreakdownThis explanation accompanies the answer,…
Q: The 5’ cap is involved in all the following except: Question 19 options: Splicing exons…
A: The processing of mRNA formed from transcription is called post transcriptional modification. Thes…
Q: Explain the concept of protein folding and its importance in determining protein structure and…
A: The objective of this question is to understand the concept of protein folding and its significance…
Q: Question 2: Part a: Complete the table describing different components of intron removal from mRNA.…
A: Part b: Group I Self-Splicing Intron Removal from 26S rRNA in TetrahymenaGroup I introns are a class…
Q: Import of fatty acids is used for which of the following? (check all that apply) Production of…
A: The import of fatty acids into a cell can be used for several purposes. Step 1. Production of…
Q: Your lunch meal contains rice, fish, vegetables and water for drinks. Identify the nutrients…
A: The objective of the question is to identify the nutrients present in a meal consisting of rice,…
Q: Which of the following compounds is the most reactive dienophile? H₂C=CH2 CH3 COOCH3 2 3 CH3 CH3
A: The most reactive dienophile in the image is compound 1, which is propenal. Dienophiles are…
Q: How is plasmid DNA distinguished from coli chromosomal DNA using the Qiagen Miniprep protocol?
A: In the Qiagen Miniprep protocol, plasmid DNA is distinguished from E. coli chromosomal DNA based on…
Q: Given that the protein Burger is found only in the blood of patients with Sillyitis, with the aid of…
A: The Enzyme-Linked Immunosorbent Assay (ELISA) is a powerful technique used to detect and quantify…
Q: Write a mechanism describing the conversion of citrate to acetyl CoA and oxaloacetate, catalyzed by…
A: ATP-citrate lyase (ACL) catalyzes the cleavage of citrate using energy from ATP to produce…
Q: The cofactor shown below: is an oxidizing agent is a reducing agent is a carrier of acyl groups is…
A: The given structure is of the FAD molecule. FAD = Flavin adenine dinucleotide.
Q: Label each Amine (A–D) in Table 1 as primary, secondary, or tertiary. Which classes of amines –…
A: Good evening,Hope this helps, Thank you!Explanation:Approach to solving the question: Detailed…
Q: For the following results of Thermodynamics of Borax Solubility, the volume of Borax solution…
A:
Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…
A: According to Watson-Crick base pairing rule, adenine (A) pairs with thymine (T) while guanine (G)…
Digestion of cellobiose in cows produces two glucose units which is then absorbed into the blood and distributed into the cells for energy production. One glucose unit is catabolized in the muscle cell while the other is in the heart cell, to CO2 and H2O in the
Step by step
Solved in 2 steps
- Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand distributed into the cells for energy production. One glucose unit is catabolized in the muscle cellwhile the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATPmolecules are released? Please show your detailed computation.Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand distributed into the cells for energy production. One glucose unit is catabolized in the muscle cellwhile the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATPmolecules are released? Show your computation.Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand distributed into the cells for energy production. One glucose unit is catabolized in the muscle cellwhile the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATPmolecules are released? Show your detailed computation. answer.
- Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand distributed into the cells for energy production. One glucose unit is catabolized in the muscle cellwhile the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATPmolecules are released? Show your detailed computation of the problem.Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand distributed into the cells for energy production. One glucose unit is catabolized in the muscle cellwhile the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATP molecules are released? Show your detailed computation of the problem.An animal cell, roughly cubical in shape with side length of 10 μm, uses 109 ATP molecules every minute. assume that the cell replaces this ATP by the oxidation of glucose according to the overall reaction 6O2 + C6H12O6 →6CO2 + 6H2O and that complete oxidation of each glucose molecule produces 30 ATP molecules. how much oxygen does the cell consume every minute? How long will it take before the cell has used up an amount of oxygen gas equal to its own volume?
- Stearic acid is an 18-carbon fatty acid. If a single molecular of stearic acid is within the cytosol of the cells: Describe the process by which stearic acid would be metabolised, beginning the molecule in the cytosol of the cell, ending with the creation of ATP, and assuming the cell has sufficient oxygen for all reactions to take place Showing all working, calculate how many ATP molecules could be generated from a single molecule of stearic acid in the cytosol of the cellThe concentration of glucose in your circulatory system is maintained near 5.0 mM by the actions of the pancreatic hormones glucagon and insulin. Glucose is imported into cells by protein transporters that are highly specific for binding glucose. Inside the liver cells the imported glucose is rapidly phosphorylated to give glucose-6-phosphate (G-6-P). This is an ATP-dependent process that consumes 1 mol ATP per mol of glucose. Given the steady-state intracellular concentrations below, calculate the theoretical maximum concentration of G-6-P inside a liver cell at 37 °C, pH = 7.2 when the glucose concentration outside the cell (i.e., [glucoseloutside) is 5.0 mM: ATP = 4.7 mM; ADP = 0.15 mM; P, = 6.1 mM For: ATP + H,O ADP + P + H* AG" = -30.5 kJ/mol and G-6-P + H,0 -→ Glucose + P AG" = -13.8 kJ/mol The glucose phosphorylation reaction is ATP + glucosenside » ADP + glucose-6-phosphate + H+Some reaction components are shown on the left. Match them to the reactions catalyzed by glutamine synthetase and glutaminase in the cell. (Multiple components on the left may match to the same option on the right. Some righthand options may have no corresponding component.) Glutamine ATP NAD+ H₂O Clear All Glutamine synthetase only Glutaminase only Both glutamine synthetase and glutaminase Neither glutamine synthetase nor glutaminase
- The average cell, at rest, hydrolyzes 10,000, 000 ATP molecules per second. You are studying the stem cell population found in the intestinal Crypts. In the intestine there are s total 5 x 1011 cell number. The stem cells have a 85% higher metabolism than an average resting cell. ATP hydrolysis yield 7.4 kCal/ Mole ATP. (Avogadro’s number is 6.023 x 1023) 1) How many moles of ATP are hydrolyzed per second? A) 15.3 moles/ sec. B) 7.06 x 10-6 moles/ sec. C) 5.4 x 10-2 moles/ sec. D) 25 moles/ sec. E) 225 moles/hour F) none of theseThe average cell, at rest, hydrolyzes 10,000, 000 ATP molecules per second. You are studying the stem cell population found in the intestinal Crypts. In the intestine there are s total 5 x 1011 cell number. The stem cells have a 85% higher metabolism than an average resting cell. ATP hydrolysis yield 7.4 kCal/ Mole ATP. (Avogadro’s number is 6.023 x 1023) 2) How many Kcal of energy are used per day by this population of cells? A) 4.514 kCal/day B) 1.14 x 10-6 kCal/day C) 1.14 x 10-4 kCal/day D) 25 kCal/day E) 225 kCalThe average cell, at rest, hydrolyzes 10,000, 000 ATP molecules per second. You are studying the stem cell population found in the intestinal Crypts. In the intestine there are s total 5 x 1011 cell number. The stem cells have a 85% higher metabolism than an average resting cell. ATP hydrolysis yield 7.4 kCal/ Mole ATP. (Avogadro’s number is 6.023 x 1023) Assuming 32 ATP per glucose oxidative metabolically, how many moles of glucose are consumed per day? A) 12,000 mole of glucose/ day B) 1.14 mole of glucose/ day C) 1.14 x 10-7 mole of glucose/ day D) 4.9 x 10-7 mole of glucose/ day E) 225 mole of glucose/ day F) 3.8 x 10-14 mole of glucose/ day Please explain how to do this!!!