Discuss in chemical detail the mechanism of action (how it works) of IMAC. Compare and contrast gel filtration chromotography with IMAC. Discuss the pros and cons for each technique. Why would a scientist prefer one technique over another? In what situations would one technique be more viable than the other?
Q: Which protein structural features are apparent in the protein structure below? Select all that apply…
A: Different bonds contribute to protein folding. These bonds are hydrogen bonds, hydrophobic bonds,…
Q: receptor/s b. the energy source c. if there is signal peptide cleavage or none E. Mitochondrion…
A: Major proportion of the mitochondrial proteins are encoded by the nuclear genes. These proteins are…
Q: 4. You are to choose the members of an expedition that will climb several high mountains. Each…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: Which is most negative at a pH of 7 Tyr-Lys-Met Gly-Pro-Ara Asp-Trp-tvr V Asp-His-Glu Leu-Val-Phe…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.
A: Catabolism is the degradative pathway. It deals with the breakdown of complex molecules into simpler…
Q: Benedict's test Green precipitate A. reducing sugars not presnt B. Reducing sugar presennt…
A: 1. Ans: A. Reducing sugar not presennt 2.Ans: B. Ketose present 3.Ans: A. Amlyose present
Q: a- Name the figure which shows the Co-translational translocation. A or B b -list the molecules…
A: The protein that are destined for secretion, the membrane proteins and the lysosomal proteins are…
Q: 3. Supra-secondary structures of proteins - supercoiled alpha- helix, Greek key, meander, interlock,…
A: Protein: The amino acids are arranged in a long chain and joined to one another by covalent peptide…
Q: In an experiment to determine the degree of saturation in 0.43 g of an unknown lipid, the following…
A: The fatty acids in triglycerides can have one or more double bonds in the hydrocarbon chain. Fatty…
Q: Consider the reaction coordinate diagram shown below. X is is ;Y
A: The above shown diagram is a reaction coordinate diagram. The free energy of the system is plotted…
Q: Which of the following is not a catabolic fate for pyruvate formed in glycolysis? fermentation to…
A: Pyruvate is the end-product of glycolysis. It is ultimately transported into the mitochondria and…
Q: Cycle of tricarboxylic acids (TCA): • importance for cellular metabolism; • intracellular…
A: It is a step wise cyclic but complete oxidation and decarboxylation of of active acetate group to…
Q: Which of the following amino acids has a side chain that can interact with the side chain of F…
A: The structure of the proteins is stabilized by the various covalent and non-covalent interactions.…
Q: 1. Discuss how the pH and temperature affect the solubility of protein. 2. Explain "salting-in" in…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: 13. How would ATP production in an aerobic yeast culture change if we add the following metabolites…
A: Aerobic yeast culture is a metabolic process in which glucose is metabolize by fermentation even in…
Q: (Multiple coenzymes on the left may match to the same reaction on the right. Some reactions on the…
A: Co enzymes are the molecules that help in accelerating the reaction rate or helping the enzyme to…
Q: 1. Enzymes A) tilt the reaction equilibrium in favor of product formation B) tilt the reaction…
A: The enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes…
Q: Increased ROS levels are a hallmark for Alzheimer's Disease. This is accurately described by all but…
A: Within a cell, reactive oxygen species are produced as a byproduct of oxygen metabolism and the cell…
Q: Briefly describe the role and location of each cofactor/coenzyme involved in the pyruvate…
A: Pyruvate produced by glycolysis. Pyruvate Dehydrogenase Complex is a mitochondrial multiple enzyme…
Q: Amino Acid Derivatives Q7.3: What explains the observation that individuals with phenylketonuria…
A: Phenylketonuria is an inborn error of metabolism. This disease is caused by mutations in the gene…
Q: Galactose 1-phosphate + UDP-glucose → UDP-galactose + glucose 1-phosphate Which pairing correctly…
A: Glycolysis is the metabolic pathway through which one 6 carbon glucose is converted into two 3…
Q: In ATP synthase, the ____ subunit is the site of ATP synthesis while the ____ subunit forms the…
A: Oxidation of glucose in the glycolysis and TCA cycle generates electrons carriers NADH and FADH2, As…
Q: Zoey Wong is a research officer at the Department of Biosciences of Tunku Abdul Rahman University…
A: The basic principles of the central dogma of molecular biology is similar in both prokaryotic and…
Q: Comment on the alignment? What is the root mean square (RMS)? Can you think of any potential issues?
A: Root mean square: In bioinformatics, the average distance between the atoms of superimposed…
Q: Determine whether each of the statements describes amyloid beta (AB) in Alzheimer's disease (AD),…
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: Explain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity…
A: The pyruvate dehydrogenase complex is composed of three subunits named pyruvate dehydrogenase,…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 8. Anaplerotic and amphibolic reactions in TCA.
A: In aerobic condition, pyruvate in the presence of pyruvate dehydrogenase complex produces Acetyl…
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown…
A: Inhibitors inhibits the enzyme activity. There are three types of inhibitors-Competitive,…
Q: When a peptide bond forms, a(n)________ reacts with an amine to form a(n). O aldehyde; aldimine O…
A: Introduction: A chain of amino acids that are linked by peptide bonds to form a protein. Peptide…
Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…
A: Insulin is a peptide hormone released by the beta cells of the pancreas. The key function of insulin…
Q: Which of the following activities are present in the endomembrane system organelles? I.…
A: Endomembrane system organelles are the connected and coordinated pathway of membrane bound…
Q: Which amino acids are exclusively ketogenic? lysine leucine tyrosine isoleucine arginine
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which of the following is not considered as a requirements for the effective binding and…
A: The translocation of proteins across ER occurs by following steps: The growing polypeptide contains…
Q: Which of the following peptides is most likely to serve as a signal sequence in human tissues a.)…
A: Peptides are polymers of amino acid residues linked via a peptide bond. Amino acids are…
Q: Incubation of the norsolinic acid synthase holo-ACP with malonyl CoA gave malonyl-S-ACP (molecular…
A: Enzymes are biological catalysts that catalyse biochemical reactions. Most enzymes are made up of…
Q: How can an understanding of enzymes and biological receptors guide medicinal chemists? Match the…
A: It was long recognized as a differentiating feature of both drug and receptor, the selectivity of…
Q: Which form of fructose ,alpha or beta does take part in most biochemical reactions
A: Two-dimensional representation of cyclic structure of monosaccharides are called Haworth projection.…
Q: Draw the catalytic triad of a serine protease at the first tetrahedryl intermediate stage. Your…
A: Serine proteases cleaves peptide bonds of protein substrates. They are called serine proteases…
Q: What amino acid(s) is(are) deemed to be present when a positive reaction is obtained upon heating in…
A: The lead acetate test is a qualitative test for sulfur-containing amino acids. The degradation of…
Q: The drug troglitazone was used to treat diabetes but was withdrawn from the market when patients who…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: 1. Deduce the primary structure of this polypeptide. 2. Why would cyanogen bromide not be a good…
A: a) Given the molecular weight of the peptide is 4000Average MW of an amino acid is 110 Da. So, the…
Q: A student is trying to add 15.0 ng of DNA template to a 20.0 µL PCR. The DNA template is at a…
A: Polymerase Chain Reaction or PCR is a method to make multiple copies of DNA starting from a small…
Q: In drug development, enzyme inhibition studies play a very important role since drugs are often used…
A: KM (Michaelis-Menten constant) of an enzyme is the substrate concentration that is required to…
Q: Consider the following reaction occurring at 298 K: OH CH₂OH OH -0. OH +ATP OH k₁ k₂ 0- -0-CH₂ to OH…
A: Biochemical reactions tend to be slow because biomolecules are stable at biological pH and…
Q: 1) Use the DNA origami model to determine the molecular formula for a base pair unit consisting of…
A: A DNA base pair unit is composed of 2 deoxyribose sugars, 2 phosphates and 2 nitrogen bases. Here…
Q: Insulin deficiency (occurrence/factors) factors affecting insulin levels including biological,…
A: The hormone insulin is in charge of permitting blood glucose to enter cells, giving them the energy…
Q: Are there any negative allosteric regulators for glycogen phosphorylase?
A: Glycogenolysis is a process of breakdown of glycogen. Glycogen phosphorylase is an enzyme that…
Q: All are single-electron carriers EXCEPT: a. UQH2. b. Cyt bL. c. Cyt bH. d. Rieske protein…
A: The process electron transport chain requires four different complexes that are situated in the…
Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
Discuss in chemical detail the mechanism of action (how it works) of IMAC. Compare and contrast gel filtration chromotography with IMAC. Discuss the pros and cons for each technique. Why would a scientist prefer one technique over another? In what situations would one technique be more viable than the other?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- You have an order for 1 gram of Cefazolin in D5W 100 ml. You have added 5 ml of sterile water to the 1 gram vial to reconstitute powder. However the recommended manufacturer’s diluent amount is 10 ml of sterile water for a final concentration of 100 mg/ml. How would reconstituting the vial with 5 mls affect the concentration and the final calculated dose. Please answer with explanation ASAP. I will really upvote. Thanks3) Define gel electrophoresis, including its theory and application. Describe the steps of running gel electrophoresis using the following image. More detailed reading: https://www.sciencedirect.com/topics/medicine-and-dentistry/agar-gel-electrophoresis POWER SUPPLY CATHODE ELECTROPHORETIC BUFFER ANODE WELL SAMPLE AGAROSE GEL POWER SUPPLY CATHODE ANOCE HIGH MOLECULAR WEIGHT SPECIES LOW MOLECULAR WEIGHT ANALYTESState the functions for each of these components used in the gel filtration chromatography using a column experiment. Bromophenol blue A mixture of albumin and bromophenol blue Spectrophotometer
- Discuss the principles and applications of Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry in molecular diagnostics.Patch clamp What is patch clamp technique? Identify two features of the patch clamp technique that make it a useful tool in studying cellular electrophysiology. Explain each thoroughly. What is the role of the reference electrode in the patch clamp technique? Discuss how it works.briefly explain the principle behind this technique; gel-filtration chromatography
- Given this, if you used 6g of vitamin Z powder to make 20 ml of solution, what is the % concentration of this solution? (I gave the image since I don't know if that info is needed to solve this question.)It also gives a follow-up, if you can help here too: You work in a lab as a summer student. One of your tasks is to make sure that there is enough cell culture medium containing antibiotics to grow bacteria. One day you realize that there is only 5 ml of 10% Antibiotic stock solution in the freezer. You decide to use it all to prepare the working culture medium with 0.01% antibiotic. In the lab there is plenty of growth medium without antibiotics. (Note: dilution in medium is like dilution in water). You remember the equation to make dilutions of stock solutions. You usually use this formula to calculate the required volume of a stock solution, but you realize it can apply here as well, even though the unknown is the final volume. So, you make that dilution. Given that each bacterial…Name two radioisotopes used within the medical imaging processes, one administered by inhalation and one used by intravenous injection. For both of these radioisotopes, what are their half-life and what is the relevance of that to why it is used? What are both of these specific use in diagnostic imaging?What are they treating?The following are errors that people commonly make when they perform serial dilutions. Indicate whether you think that the number of cfu/ ml calculated would be too high or too low if you make this mistake. You intend to add 0.9 ml of diluent to each tube and 0.1 ml of culture. Instead, you add 0.5 ml of diluent to each tube and 0.1 ml of culture to the first tube. Then, you make a serial dilution of 0.1 ml into and from each tube as described. You prepare 0.9 ml of diluents in each tube. You add 0.1 ml of culture (from the overnight culture provided) to every tube. You add 0.9 ml of diluent to each tube. You add 0.1 ml of culture to the first tube and mix. You get distracted, and transfer 0.1 ml to the third tube instead of the second. You perform the rest of the series as described.
- Which of the following technique is FALSE in microscopy? Osmium tetroxide can be used as a fixative as well as a negative stain in transmission electron microscopy. Two proteins; each tagged with their individual primary antibody followed by one protein with rhodamine conjugated secondary antibody and the other with fluorescein-conjugated secondary antibody can be visualized simultaneously using a fluorescence microscope. The emission spectrum of Rhodamine is 580 nm The emission spectrum of Fluorescein is 521 nm O An objective lens with 100X magnification and projection lens with 10X magnification is going to produce a 1000X total magnification. Phase contrast and differential interference contrast (DIC) do not require staining.A flow cytometer is constructed of many components. For good quantitative results how and how frequently should the various systems be calibrated? What is MESF and how does it apply in flow cytometry?What can be the errors and limitations of Gel Electrophoresis practical? Explain in very much detail and also provide some better suggestions.