Do ostriches bury their head in the sand? 2. Please identify the 3 world records held by the common ostrich. 3. Who is Wisdom and what record does she hold? 4. What are salt glands and why do seabirds have them?
Q: True or false: A polypeptide amino acid sequence ultimately determines the function of a protein. 
A: The proteins are made up of amino acids and these amino acids are together bounded by polypeptides.…
Q: Defining occupational health and safety and its importance in the work environment.
A: occupational health deals with all aspects of health and safety in the workplace and has a strong…
Q: What are the primary and the secondary constrictions of a chromosome? What is the other name given…
A: Chromosome At the time of cell division the chromatin material get condensed to form chromosomes…
Q: A cross between plants having seed character RRY (round, green) and rrYY (wrinkled, yellow) will…
A: A Dihybrid cross is a cross between two individuals with two different traits. These two different…
Q: Which of the following helps Human sperm with locomotion? a) Flagellum b) Basal body c) Nucleosome…
A: *Sperm is male reproductive gamete that produce motile sperm with a tail called as flagellum…
Q: what is systematic, phylogenetic tree and phylogeny?
A: Phylogenetics is the observe of the evolutionary history of dwelling beings. Both principles are…
Q: Match the subfamilies of HSPGS withe their examples v syndecans and CD44V3 A. Secreted ECM…
A: Proteoglycans are mucoproteins that are formed of glycosaminoglycans that are covalently attached to…
Q: In goats, the gene for coat color is on an autosome and light brown color is dominant to black. A…
A: Let the gene determining the same be B/b So light brown male is BB Dark brown female is bb BBX bb Bb…
Q: What are the external anatomy of a cat and its function? 2. What are the external anatomy of a…
A: Answer
Q: True or false: A somatic cell mutation may be passed on to offspring
A: Somatic cells and germ cells are the two types of cells found in the body. Mutations in any of the…
Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…
A: * Okazaki fragment are short sequences of DNA nucleotides. * They are of approximately 150 to 200…
Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: A single strand…
A: Single stranded binding proteins prevent single stranded DNA from exonuclease activity during…
Q: Describe the difference between the nerve and muscle in response to increasing stimulus voltage.
A: Introduction A nerve is a cable-like structure within the body composed of neurons that uses…
Q: What are some examples of organs and tissues where mitosis is more frequent, less frequent or…
A: Introduction - Mitosis is a stage of the cell cycle in which duplicated chromosomes are split into…
Q: The process of __________ usually involves modification and selectivity
A: Introduction Breeding is a type of sexual reproduction that results in formation of offspring, which…
Q: Why is Trisomy 21 more common than other trisomies (e.g. Trisomy 1, Trisomy 2, etc.)? The size of…
A: Answer :-(C) Trisomy 21 are caused by nondisjunction, which occurs when pairs of homologous…
Q: Name the two kinds of tissues present in the bone? a) Cancellous tissue and non-compact tissue b)…
A: Introduction - Compact tissue (the hard, outer layer) and cancellous tissue (the soft, inner layer)…
Q: What is the root cause of internal splintering?
A: A splinter hemorrhage causes a person to have longitudinal streaks down the nails, which typically…
Q: Can two normal individuals of the same species with sexual reproduction have identical genomes and…
A: The karyotype of an organism depicts the arrangements of its chromosomes. It is used to demonstrate…
Q: Division of human egg is a) Holoblastic and equal b) Holoblastic and unequal c) Isoblastic d)…
A: Introduction - One of the largest cells in the human body is the human egg, or ovum. It is, however,…
Q: Natural selection means that the environment favors survival of some genotypes. From where does…
A: Natural selection can also give certain people a reproductive edge over others. Natural selection…
Q: The enzyme hexokinase adds a phosphate toD-glucose but ignores its mirror image, L-glucose.…
A: Hexokinase is found in all metabolising cells of the body, whereas glucokinase is found in liver and…
Q: An enzyme that acts as both a kinase and phosphatase in rxn. of 1 uM 1,3-bisphosphoglycerate,…
A: An enzyme that adds phosphate groups (PO43) to other molecules is known as kinase. Kinases are…
Q: 12. Below is a diagram of a cell. Which of the following is true? a. The cell is a plant cell,…
A:
Q: what type of stem cells are found in the bone marrow and skin that go through mitosis frequently to…
A: Stem cells are unspecialized cells that has the ability to divide for indefinite periods and give…
Q: All herbivore species are small such as insects and would not be able to have massive muscular…
A: * Herbivores are organisms that feeds on plants and they can range in size from tiny insects like…
Q: 13) Draw a graph representing the changes in membrane potential across the axonal membrane before,…
A: The electric signals that flow down the dendrites to form a nerve impulse or an action potential are…
Q: what is a genetic map? List two areas where genomics can be applied.
A: Introduction A gene is a basic unit of heredity that encodes the production of a gene product, such…
Q: Abacteria isolated from Yellowstone National Park is found to use the chemical methane as a food…
A: Chemotrophs are organisms whose energy source is obtained by the oxidation of inorganic…
Q: The eukaryotic transcription factor that exhibits a sequence specificity for the TATA box is: A)…
A: Transcription is the first step in the gene expression which transfers the genetic information…
Q: Rain falls on a fertilized agricultural field after a farmer has harvested the crop. Which…
A: Macronutrients of plants include Carbon, Nitrogen, Phosphorous along with the role of water. In…
Q: Discuss the strengths and weakness of the traditional Innovative health financing mechanisms
A: The purpose of health financing is to make funding available, as well as to set the right financial…
Q: 1. What causes the light pink to bright red coloraion of most adult flamingos? 2. Please describe…
A: Introduction Flamingos are a type of wading bird in the family Phoenicopteridae, they are very…
Q: You treat cells with 2,4 dinitrophenol (DNP). This compound creates a temporary channel in the inner…
A: DNP is a compound that is toxic and highly flammable/explosive. It uncouples oxidative…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: As a young girl, Maria suffered a head injury that damaged her pituitary. An injury to the pituitary…
A: Lungs are essential parts of the respiratory system. A pair of lungs in humans are formed in such a…
Q: What is the nucleolus?
A: The nucleolus which is the region present inside the nucleus of a cell and they plays important role…
Q: Construct a comparative matrix on different sterilization methods.
A: In our enterprise groups, it’s vital to have an expansion of sterilization methods so that you can…
Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…
A: * Hypo complementaemia can be referred as decreased complement levels and secondary complement…
Q: 9. What slide preparation technique should you use for the following research goals? Briefly justify…
A: Answer :- a) Maceration technique In maceration the complex substance is broken down into simple…
Q: which type of transmembrane protein binds to insulin and opens a transport proteins allowing glucose…
A: Insulin is an peptide hormone secreted by the beta cells of the pancreas acting through a receptor…
Q: In order for transcription to begin, the DNA-duplex must be "opened" to allow RNA polymerase access…
A: RNA polymerase is an enzyme found in the nucleoplasm of nucleus. It is involved in the…
Q: An advantage of gas exchange in water, compared with gas exchange in air is that water usually…
A: Gas change is the process by means of which oxygen and carbon dioxide flow among the bloodstream and…
Q: Why is the base pairing in D N A important? How does mRNA production in eukaryotes differ from the…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide sequences which curl around…
Q: Hydrophobic and hydrophilic: how do aquatic insects locomote on the surface of water?
A: Hydrophilic and hydrophobic The word Hydrophilic is a combination of two words i.e. "Hydro" which…
Q: Discuss the environmental consequences of biomaterials compared to non-biomaterials.
A: A biomaterial is a substance that has been developed to interact with biological systems for…
Q: Question 47 The proofreading of DNA is essential for faithful replication. A) True B) False
A: Proof reading of DNA is essential for maintaining a homogenous DNA across multiple cycles of…
Q: Stainable living strategies for people living in the Savanna Desert in Amboseli National Park…
A: Sustainable strategies are those strategies which are plant in a way to protect the environment not…
Q: How many copies of succinate dehydrogenase are found in a respirasome?
A: Respirasome, as a vital part of the oxidative phosphorylation system, undertakes the task of…
Q: Describe the steps of transcription in eukaryotes
A: Eukaryotic transcription is carried out in the nucleus of the cell by one of three RNA polymerases,…
1. Do ostriches bury their head in the sand?
2. Please identify the 3 world records held by the common ostrich.
3. Who is Wisdom and what record does she hold?
4. What are salt glands and why do seabirds have them?
Step by step
Solved in 2 steps with 1 images
- 4) Animals that undergo ecdysis, or molting, include nematodes and arthropods. Why do these animals molt? Group of answer choices shedding the exoskeleton allows the animal to move faster to escape predators the exoskeleton prevents them from obtaining oxygen their outer covering is made of a non-living substance shedding the exoskeleton makes the animal smaller, which makes it easier for the animal to hide from predators in crevices8. What is the difference between an open and a closed circulatory system? 9. What is a radula? What is it used for? 10. Define regeneration. 11. Identify distinguishing traits of most arthropods. 12. What is molting? Why does it occur? 13. Name three arthropod head appendages and state their functions. 14. Describe two structures that allow arthropods to breathe air.1. Who is Wisdom and what record does she hold? 2. What are salt glands and why do seabirds have them? 3. Why do pelicans hold the symbol of self sacrifice? 4. Please describe nest building behavior in the hamerkop.
- _1. Which of the following is/are not vertebrate appendage/s? a. scale b. antler c. pereiopods d. horn e. proboscis f. antenna _2. Which of the following activities is not carried out by every cell in the body? a. obtaining oxygen and nutrients b. performing chemical reactions to acquire energy for the cell’s use c. eliminating wastes d. largely controlling exchange of materials between the cell and its external environment e. reproducing1. What is the function of the gill rakers?2. Explain how gas exchange occurs at the gills.3. What is the function of the lateral line?4. Describe how the scales are arranged on the trunk & tail of a tilapia.5. Explain how the swim bladder controls buoyancy.1. How do clams open and close their shells? 2. How does a clam draw water into its mantle cavity? What is the purpose of this behavior? 3. Describe the shape of a clam’s foot and explain how the clam uses it for movement.
- 7. Primates have prehensile hands (and sometimes they have prehensile feet). What does this mean? OA. They have five digits on each hand and foot. B. They have nails rather than claws. C. Their hands are adapted for seizing or grasping. OD. They have an opposable thumb, which allows for a precise grip. O 17:48:40 q W SIS y U1. Why do loons have difficulty walking on land? 2. Where do baby loons spend most of their time after hatching? Why? 3. Please describe how grebes use their unusual feet to swim. 4. Please choose a species of grebe and describe its courtship ritual.4. Describe how the scales are arranged on the trunk & tail of a tilapia.5. Explain how the swim bladder controls buoyancy.
- 7. Primates have prehenslle hands (and sometimes they have prehensile feet). What does this mean? O A. They have five digits on each hand and foot. O B. They have nails rather than claws. C. Their hands are adapted for seizing or grasping. O D. They have an opposable thumb, which allows for a precise grip. 17:48:40 esc W eTo brachiate is to O move around suspended from branches like a Siamang to leap from tree to tree like a lemur O walk on all fours on the tops of branches like a monkey O to walk on two feet like a hominin O to knuckle walk like a chimp5a. Define each of the 3 categories of mammals: Eutherians Marsupials Monotremes: