Draw the arrow-pushing mechanism for this knowing that histidine amino acid residue acts as a general base and a lysine amino acid residue acts as a general acid. Please make it detailed and neat.

Q: A segment of DNA containing 20 base pairs includes 7 guanine residues. How many adenine residues are…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: Which of the following a.B-D-ribose b. thymine c. phosphate which is not a component of…

A: Deoxyribonucleotide means DNA. DNA acts as genetic material in most of the organisms present on the…

Q: amino acid in the form of a "phenylthiohydantoin" (PTH-amino acid), are shown below. What is the…

A: Phenyl isothiocynate is the Edman reagent. It reacts with N-terminal amino acid to give phenyl…

Q: Illustrate the titration curve of the peptide with the given sequence below. Show the pKas,…

A: The given peptide is composed of eight amino acids attached together via peptide bonds. All the…

Q: Histidine: draw the amino acid side chain and give the single and three letter abbreviation.

A: Histidine is known as a semi-essential amino acid because it is synthesized in the body in adults…

Q: In pyrimidine nucleosides the anti conformation predominates because of steric interactions with…

A: Pyrimidine nucleosides have anti-conformation as the oxygen molecule present on the second carbon is…

Q: Given the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in…

A: Biuret test is a test used for detecting the presence of peptide bonds. Biuret Reagent is  formed by…

Q: In a sample solution given to be analyzed; Starch + Val-Gly-Ile-Trp-Lys-Gly-Ala-Gly-Val-Glu  Plan…

A: Peptide bond binds the amino acid together and forms a linear chain ,more than 10 amino acids are…

Q: Draw the structure of following peptide: Glu-Asp-His-Cys-Gly-Arg (B) At pH= 10.7 (A) At pH= 2.1

A: Amino acids are organic compounds having two functional group namely carboxyl and amino. Amino acids…

Q: What is the name of this tripeptide, using the three-letter amino acid abbreviations? Capitalize the…

A: Peptide or protein sequence is a linear chain of amino acids. There are 20 main different types of…

Q: The peptide below NH-CH- HẠN CH- ČH, -NH-CH- NH-CH- NH-CH- OH CH2 CH2 CH2 HN-ç=NH, NH2 CH2 CH HO-CH,…

A: Amino acids are the building blocks of peptides. The net charge on a peptide depends on the sequence…

Q: Calculate and draw a line graph of the pI of the following: a. Histidine b. Arginine c. Aspartic…

A: pI: the pH at which an amino acid exits as a zwitter ion is called iso electric point. It is…

Q: How do you think incorporating b-homoserine into a peptide would affect the structure and/or…

A: Homoserine, is the product of a cyanogen bromide cleavage of a peptide by degradation of methionine.…

Q: Would the side chains in the Leu-Thr-Met-Val-Trp-Gly-Pro of a polypeptide be located on the interior…

A: 1.Amino acids that are hydrophobic (water-fearing) in nature are mostly found interior of the…

Q: Discuss the Pharmacokinetics of morphine sulfate using the correct sequence you  have chosen in…

A: Morphine is a drug that targets a specific type of receptor that affects multiple processes. It does…

Q: Indicate which base is (or bases are) the complementarypaired base(s) for each of the…

A: Answer: Introduction: DNA - Deoxyribonucleic acid is a molecule that is used for storage of genetic…

Q: a. d(pAACGTCTC) b. pGUAACUGC

A: Oligonucleotides are the short DNA or Rna molecules known as oligomers.

Q: What are the sequences of all the possibletripeptides that contain the amino acids aspartic acid,…

A: Amino acids are the building blocks of proteins. They contain amino group, carboxyl group, and…

Q: What is the Shine–Dalgarno sequence? What role does it play in protein synthesis?

A: The prokaryotic protein synthesis takes place in the ribosomes where the mRNA was translated into…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: The purine and pyrimidine rings are built from the amino acids aspartate,glutamine, and glycine. Why…

A: A deoxyribonucleotide is a nucleotide that contains deoxyribose. They are the monomeric units of the…

Q: What is meant by the binding problem, and what is necessary for binding to occur?

A: "The Binding Problem" is one of the most well-known open questions in computational neuroscience.…

Q: What function does a guanine nucleotide exchange factor(GEF) serve?

A: Small GTPases or small G-protein is a type of hydrolase enzyme found in the cytosol of the cell.…

Q: Determine the codon sequence for the peptide sequence glycylserylcysteinylarginylalanine. How many…

A: Translation is the sequences process where the mRNA was translated into a polypeptide chain. Where…

Q: Is the sugar in the nucleotide deoxytibose or ribose? How do you know?

A: DNA/RNA is made up of monomers of nucleotides .

Q: Describe the steric interactions that determine the conformations that pyrimidine nucleosides…

A: Pyrimidine is an organic compound which has heterocyclic ring. It fuses with the nitrogenous bases…

Q: Why is selenocysteine called the 21st amino acid when there are many more amino acids found than the…

A: Introduction: The 21st proteinogenic amino acid is selenocysteine. It is an essential amino acid.…

Q: Trypsin cleaves polypeptide chains at the carboxyl side of a lysine or arginine residue.…

A: Trypsin is a serine protease found in the digestive system of many vertebrates. It helps in breaks…

Q: How do you think incorporating a-methylserine into a peptide would affect the structure and/or…

A: proteins are made up of amino acids . amino acid polarity and peptide struture depends upon the side…

Q: What are the sequences of all the possible tripeptides that contain the amino acids aspartic acid,…

A: The polypeptide chain is made up of amino acids which are joined by the polypeptide chain.

Q: Why is it no longer considered necessary to determine theN-terminal amino acid of a protein as a…

A: Proteins are the building blocks of the body. It plays an essential role in the body. Many enzymes…

Q: _____________ are degrons with sequences containing proline, glutamate, serine, and threonine…

A: Peptides are chain of amino acids containing few amino acids. The amino acids are attached with…

Q: Based on the following image, what is the N-terminal AA residue, C-terminal AA residue? What is also…

A: With 2,4-Dinitrofluoro benzene forms DNP-Thr so, the N-terminal aminoacid is Thr with Trypsin :…

Q: What kind of repeating polynucleotide would yield a single polypeptide with a tetrapeptide repeating…

A: Polynucleotide is a sequence of nucleotides. Nucleotides consist of a sugar molecule, a phosphate…

Q: Explain the importance of Chargaff's rules and the complementary nature of nucleotide bases.

A: Erwin Chargaff proposed Chargaff’s rule. Chargaff’s rule played important role in the discovery of…

Q: Consider a hexapeptide of the sequence thr asn glu trp lys gln. A researcher decided that this…

A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…

Q: Which amino acid (also called amino acid residue)would be more likely to occur on the surface of a…

A: Amino acids are the monomers of the proteins .Based on the chemical nature of the side chain  the…

Q: Consider the following protein sequence as an α helix:…

A: The sequence and identity of amino acids of a polypeptide chain make its primary structure.

Q: Using the standard 3.6 amino acids per turn (360°) and the helical wheel below, plot each sequence…

A: A helical wheel is a visual representation of amino acids that is used to illustrate the alpha…

Q: If a polyribonucleotide contains equal amounts ofrandomly positioned adenine and uracil bases, what…

A: Polynucleotide with ribonucleotides as mononucleotides is known as a polyribonucleotide. Nucleic…

Q: What useful information might you get if you did determine the N-terminal amino acid as a separate…

A: N-terminal amino acid : Within a peptide, the amine group is bonded to another carboxylic group in a…

Q: In studies using repeating copolymers, AC . . . incorporates threonine and histidine, and CAACAA . .…

A: A protein's amino acid sequence is determined by the sequence of nucleotides in DNA and RNA.  It is…

Q: Write the anticodons for the following amino acids: a) Met   b) Trp    c)  Ser    d)   Leu

A: The codon is defined as a sequence of three RNA or DNA bases, which correspond with a specific amino…

Q: Why does enzyme x catalyze the formation of the phosphodiester bond and please explain how nucleas…

A: The phosphate groups in the phosphodiester bond are negatively charged. the phosphate groups have a…

Q: Hypoxanthine can also base-pair with cytosine. Draw the structure of this base pair.

A: Mutations sometimes are responsible for the change in the base pairing of the DNA. This change…