Q: Chromosome breakage followed by DNA repair, orillegitimate crossing-over in which _____________…
A: Chromosomal rearrangement encircles many different classes of events such as duplications,…
Q: Voca geneticist dna genetic counselor karyotype cystic fibrosis mutation pedigree sickle cell…
A: Introduction :- A chromosome is a lengthy DNA molecule that contains part or all of an organism's…
Q: Options : Sex XY mutations reversal SRY feminization
A: Sex determination is the process that determines the biological sex of an offspring. Humans develop…
Q: t for them to get a robust exp chat these genetic marks were ow. Draw the distribution of r ree…
A:
Q: Mapping a new mutation on the same chromosome as the mapping genes: Scenario 1 1. If the m mutation…
A: Genotype It is the genetic makeup of an individual, while the phenotype is the physical appearance…
Q: pros of phenotyping
A: The physical traits expressed by the organism are called the phenotype. This phenotype is the mixed…
Q: DNA fingerprinting compares between different individuals. differences in fingertip cells O…
A: Deoxyribonucleic acid (DNA) fingerprinting is an analysis used to identify individuals and to…
Q: Chromosomal ____________include those that removeor add base pairs (deletions and duplications), and…
A: Chromosome is a thread like structure containing a part or all of the genetic material of an…
Q: Higher mutation rate in human sperm thanin human eggs WHY?
A: The mutation is a change in the DNA sequence, results from errors in "DNA replication" that occurs…
Q: 2. Genetic changes resulting from mutations can be harmful, beneficial, or neutral. Explain, using…
A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…
Q: Mutation: Lobe eye shape P generation Phenotypes: Normal Lobe female X male Fi generation Phenntvne…
A: The mode of inheritance is a pattern of obtaining parentral alleles or genes to the offsprings. The…
Q: hat happens when one nucleiotide is lost or changed from the middle of a gene? Describe to me, or…
A: When a deoxyribonucleic acid factor is destroyed or altered in such the simplest way that the…
Q: ection 3: X-linked genes Consider the following pedigrees. Each represents inheritance of a…
A: Autosomal traits appear with equal frequency in both sexes. X-linked recessive inheritance is a mode…
Q: . Usually, the deletion of a gene results in a recessive mutation. Explain how the deletion of an…
A: A recessive mutation is one in which the mutated gene has to be present on both of the homologous…
Q: Genetic Inheritance Patterns Retinitis pigmentosa (RP) can be autosomal recessive, autosomal…
A: Given The disease only occurs in recessive condition. When both gene is in recessive condition.…
Q: Re-establishing centromere borders have no impact on gene expression. True False
A: * Centromere will links the sister chromatid pair together during cell division. constricted region…
Q: op an analogy for the processes researchers use to make changes to DNA. In y gy, explain how it is…
A: Gene editing is the process by which researchers make changes in the DNA sequence. Gene editing…
Q: AKS 6a/b Mutations Which of the following statements accurately describes genetic mutations? O…
A: Mutation is a process where DNA or chromosome can be altered and the characteristic of an…
Q: DNA is responsible for your phenotype, but to what extent? How much, if at all, do environmental…
A: An organism's phenotype results from two basic factors: the expression of an organism's genes or…
Q: enerations, what must be true about the mutation?* OIt must occur during the first stage of DNA…
A: Mutations are the abrupt change in the nucleotides of the DNA which may prove harmful as well as…
Q: True or False? Mutations are always harmful to a cell or a virus. O True O False
A: A mutation is considered as a change in a DNA sequence. Mutations can be a result of DNA copying…
Q: Look up these mutations 1 by 1… vestigial wings, white eyes, sepia eyes, ebony body. For each…
A: Drosophila, commonly known as the fruit fly has large wings, gray body colour and red eyes as the…
Q: ONE gene for the betterment of human kind, which one would be better and why?
A: Genes are responsible for variety of characteristics and quirks we have Genes are the source of…
Q: In nucleosomes, DNA wrapped around octamar of histone proteins O False True
A: A histone octamer is the eight protein complex found at the focal point of a nucleosome center…
Q: Hair: DNA: CCGGTGTACACAGGGACCATTCGATTA MRNA: protein: phenotype:
A: According to the central dogma of molecular biology, the information stored in the DNA is first…
Q: nucleotide is in the left column, and second codon nucleotide is on top. The m allele sequences are…
A: Sense strand of the coding strand is the segment of DNA that carries the code that can be…
Q: Regulation of conservative DNA through GATC(guanine adenine thymine cytosine) methylation.
A: DNA is usually defined that they have two-stranded molecules that have complementary base pairing…
Q: 14 Linkage Between Genes Testcross: RL/ rl X rl/ rl
A: According to the law of independent assortment, the alleles of different genes segregate…
Q: v constructed gene. What will
A: introduction pGLO is a genetically engineered plasmid which incorporates parts of the arabinose…
Q: alpha-globin in cow and pig O orthologous genes O paralogous genes O pseudogenes O all of these
A: Homologous genes are those genes which are similar in sequence but are not identical. Based on the…
Q: uncements Aules Graw-Hll nect abus des ple kstore Some of the chromosomes in this model are partly…
A: Mitosis is a process in which there is cell division which produces two identical diploid daughter…
Q: myoglobin and alpha globin in humans O orthologous genes O paralogous genes pseudogenes O all of…
A: a. Homology means similarity between the characters as it is shared from the ancestry and its forms…
Q: Human genome project
A: Human genome project is an international scientific research project with the goal of determining…
Q: Any change in WT DNA sequence without any phenotypic appearence Mutant Mutation Genotype Phenotype
A: Any change occurs in wild type DNA sequence is called mutation.
Q: When the DNA is loosened, i.e. unwound from the histones? B. Reading of genes remains the same. A.…
A: The gene is the fundamental basis of inheritance. DNA is the genetic material that contains all the…
Q: t is points mutations.
A: A mutation may be a modification in a very deoxyribonucleic acid sequence. Mutations may end up from…
Q: Describe 6 different types of mutations that can occur at the chromosomal and nucleotide levels.…
A: Mutation is a permanent change in the nucleotide sequence of an organism's genome, virus,…
Q: Explain why I− alleles in the lac system are normally recessive to I+ alleles and why I+ alleles are…
A: The I gene is the gene that is used for determining the process of synthesis of a repressor…
Q: mutation would be least harr
A: (a) Silent mutations are when the mutations do not have any observable effect on the phenotype of an…
Q: Jsing the picture below determine the type of mutation that has occurred. Mutated Chromosome
A: Any abrupt alteration in the nucleotide sequence of genes is defined as a mutation. It can also be…
Q: n the Central Nervous system, Hox genes are involved in segemation of... ( Choices are cerebral…
A: Answer. Hox genes are master regulator genes that determine the type of segment structure. These…
Q: 20. Genetic linkage causes alleles located on the SAME chromosome to be inherited togeher.
A: In a chromosome, there are thousands of genes present. All the genes are present at a specific…
Q: DNA Methylation What does DNA methylation mean (with figures/narratives) How does DNA methylation…
A: In eukaryotes, DNA methylation occurs predominantly at CpG dinucleotides sequence. In CpG, the…
Q: Genetic Inheritance Patterns Retinitis pigmentosa (RP) can be autosomal recessive, autosomal…
A: Eric has usher syndrome which is autosomal recessive which is already given . Understand the concept…
Q: In regards to satellite DNA, the major difference between a LINE sequence and a SINE sequence is the…
A: In molecular biology, there are two types of genes ,coding and noncoding. Coding genes helps in the…
Q: Product of gene mutation orthologous genes paralogous genes pseudogenes O all of these
A: Introduction A Mutation Occurs When The Sequence Of DNA Is Altered. Mutations Can Occur As A Result…
Q: Some loss of function variants can cause haploinsufficiency in autosomal dominant alleles TRUE OR…
A: Haploinsufficiency means a single allele is not efficient for a gene to function normally.
Q: The reason due to which scientists think that new genes arise by the duplication of an original gene…
A: Genes are usually known to define that they are the fundamental building block and essential…
Please assist ASAP, a like is surely guaranteed!
Step by step
Solved in 2 steps
- 1. In a plant species, flower-colour is determined by the biochemical pathway shown below: E A D Colourless blue yellow purple red Genes A, B, C, D, and E are independently assorting. The dominant alleles A, B, C and D encode enzymes that catalyse the corresponding reactions indicated above. The recessive alleles a, b, c and d are non-functional and do not produce active enzymes. The dominant E allele totally inhibits the action of gene C, while the recessive allele e has no effect. a) Determine the F1 and F2 phenotypes from a cross between AAbbCCDDEE and AABBCCDDee plants. b) What proportion of the offspring of an AaBBCCDdEe x AaBBCcDdEe cross is expected to have coloured flowers?. The production of pigment in the outer layer of seedsof corn requires each of the three independently assorting genes A, C, and R to be represented by at leastone dominant allele, as specified in Problem 64. Thedominant allele Pr of a fourth independently assortinggene is required to convert the biochemical precursorinto a purple pigment, and its recessive allele pr makesthe pigment red. Plants that do not produce pigmenthave yellow seeds. Consider a cross of a strain of genotype A/A ; C/C ; R/R ; pr/pr with a strain of genotypea/a ; c/c ; r/r ; Pr/Pr.a. What are the phenotypes of the parents?b. What will be the phenotype of the F1?c. What phenotypes, and in what proportions, willappear in the progeny of a selfed F1?d. What progeny proportions do you predict from thetestcross of an F1?In a species of tree, seed color is determined by four independently assorting genes: A, B, C, and D. The recessive alleles of each of these genes (a, b, C, and d) produce abnormal enzymes that cannot catalyze a reaction in the biosynthetic pathway for seed pigment. This pathway is diagrammed as follows: A White precursor Yellow ----Orange----- Red --- Blue When both red and blue pigments are present, the seeds are purple. Trees with the genotypes Aa Bb Cc Dd and Aa Bb Cc dd were crossed. (a) What color are the seeds in these two parental genotypes? (b) What proportion of the offspring from the cross will have white seeds? (c) Determine the relative proportions of red, white, and blue offspring from the cross.
- In sweet peas, the synthesis of purple anthocyanin pigment in the petals is controlled by two genes, B and D.The pathway iswhiteintermediateblueintermediateanthocyanin(purple)gene Benzymegene Denzymea. What color petals would you expect in a purebreeding plant unable to catalyze the first reaction?b. What color petals would you expect in a purebreeding plant unable to catalyze the second reaction?c. If the plants in parts a and b are crossed, what colorpetals will the F1 plants have?d. What ratio of purple : blue :white plants would youexpect in the F2?1. In corn, male sterility is controlled by maternal cytoplasmic elements. This phenotype renders the male part of corn plants (i.e. the tassel) unable to produce fertile pollen; the female parts, however, remain receptive to pollination by pollen from male- fertile corn plants. However, the presence of a nuclear fertility restorer gene F restores fertility to male-sterile lines. Using the following color-coded circles, simulate the crosses indicated below. Put the illustrations of crosses in the spaces provided. Be sure to include in the labels the genotypes and phenotypes of the offspring in each cross. Big light green circle cytoplasm Big orange circle cytoplasm Small orange circle Small half-light green-half-orange circle - Ff nucleus Small light-green circle - male-sterile - male-fertile - FF nucleus - ff nucleus a. Male-sterile female x FF male (the term male-sterile is an adjective that describes the female) b. Male-sterile female x Ff male (the term male-sterile is an adjective…A mutation that breaks which of the following genes would be most likely to produce theanthocyanless phenotype of the green-stem Wisconsin Fast Plants (meaning no purple stems):PAL, CHS, C3H, FLS, or DFR? Explain your reasoning.
- 8. Kernel color in wheat is controlled by 2 pairs of genes (AABB). Determine the color of the offspring with the following genotypes: (Note: 4 contributing alleles – red; 3 contributing alleles – medium red; 2 contributing alleles – intermediate red; 1 contributing allele – red; and 0 – white AAbb x AaBb AABb x Aabb aaBb x Aabb AABb x aabb AABb x AaBb A wheat plant producing medium red seed is crossed with another plant producing intermediate red seed (refer to problem no. 8). How many individuals will be? Red Medium red Intermediate red Light red White5) Scale color in dragons is determined by two genes. The W gene is epistatic to the G gene. The W allele is dominant and allows the production of pigment, while w is recessive and blocks pigment formation, resulting in white dragons. When pigment formation is possible, the dominant G allele results in green dragon scales, while the recessive g allele results in black dragon scales. The pigment formation pathway is shown below. (3 points) W (Enzyme 1) G (Enzyme 2) White precursor Black intermediate pigment Green pigment a. What color scales would you expect in each of the following dragons? WwGg Wwgg wwGG wwgg b. If you cross two dragons with WwGg genotype, what is the expected phenotypic ratios of the progeny? c. What kind of epistasis do we observe?5) Scale color in dragons is determined by two genes. The W gene is epistatic to the G gene. The W allele is dominant and allows the production of pigment, while w is recessive and blocks pigment formation, resulting in white dragons. When pigment formation is possible, the dominant Gallele results in green dragon scales, while the recessive g allele results in black dragon scales. The pigment formation pathway is shown below. W (Enzyme 1) G (Enzyme 2) White precursor Black intermediate pigment → Green pigment a. What color scales would you expect in each of the following dragons? WwGg Wwgg wwGG wwgg b. If you cross two dragons with WwGg genotype, what is the expected phenotypic ratios of the progeny? c. What kind of epistasis do we observe?
- In sweet peas the synthesis of purple anthocyanin pigment in the petals is controlled by two genes, B and D. The pathway is: Enzyme B →Blue Intermediate Enzyme D → White Intermediate Anthocyanin (purple) What color petals would you expect in a pure-breeding (homozygous) plant unable to catalyze the first reaction (white to blue)? [Select] What color petals would you expect in a pure-breeding plant unable to catalyze the second reaction (blue to purple)? [Select] If the plants in parts a and b are crossed, what color petals will the offspring have? [Select]In a certain species of flowering plants with a diploidgenome, four enzymes are involved in the generationof flower color. The genes encoding these four enzymes are on different chromosomes. The biochemical pathway involved is as follows; the figure showsthat either of two different enzymes is sufficient toconvert a blue pigment into a purple pigment.→ white → green → blue → purpleA true-breeding green-flowered plant is mated with atrue-breeding blue-flowered plant. All of the plants inthe resultant F1 generation have purple flowers. F1plants are allowed to self-fertilize, yielding an F2 generation. Show genotypes for P, F1, and F2 plants, andindicate which genes specify which biochemicalsteps. Determine the fraction of F2 plants with thefollowing phenotypes: white flowers, green flowers,blue flowers, and purple flowers. Assume the greenflowered parent is mutant in only a single step ofthe pathwaySome sweet-pea plants have purple flowers and others have white flowers. A homozygous variety of sweet pea that has purple flowers is crossed with a homozygous variety that has white flowers. All the F1have purple flowers. When these F1 self-fertilize, the F2 appear in a ratio of 916 purple to 716 white. a.Draw a hypothetical biochemical pathway to explain the production of purple and white flowers in sweet peas.