Explain how these polymers are digested and how the products of digestion are used in the human body. a. Starch b. Triglyceride

Q: Most land animals with exoskeletons are smaller than the volume of a mouse, and most vertebrates are…

A: Insects belong to the phylum Arthropoda and it is the largest phylum in the animal kingdom…

Q: Compare the reproductive organs of reptiles and birds. How are their reproductive patterns…

A: The skin of the reptiles is covered by scales or Bony plates.  Birds body are supplied with feathers…

Q: To determine: The special properties that an enzyme isolated from a psychrophilic bacterium will…

A: Introduction Proteins that operate as biological catalysts are known as enzymes. Chemical reactions…

Q: Which of the following statements is most correct about the speed of neural transmission? Myelinated…

A: "The nervous system" of all animals is made up of unique cells known as neurons, which serve as the…

Q: In Mirabilis jalapa, all three shoot color phenotypes (pale, green, or variegated) are possible in…

A: Uniparental inheritance is a non-mendelian form of heredity in which genotypes are passed down from…

Q: To define: The term allosteric enzyme and allosteric effector.

A: A metabolic pathway is a series of interconnected biochemical reactions that convert a substrate…

Q: "BIKINI BOTTOM GENETICS" Use the information for SpongeBob's traits to write the phenotype (physical…

A: A trait is a characteristic features that is unique to particular individual . In the question ,…

Q: The circulation and the homeostasis of the cellular environment:  Describe (in the correct order)…

A: Introduction Homeostasis, which is described as a self-regulating mechanism through which an…

Q: Instruction - Please answer them correctly - Please answer all of them, they are connected. PEDIGREE…

A: (According to Bartleby guidelines, only the first three subparts have been answered. Kindly post the…

Q: Which muscles types are under voluntary control: Skeletal O Smooth O Cardiac O All the above

A: Introduction:- Cardiac, smooth, and skeletal muscle tissue are the three forms of muscle tissue.…

Q: Occasionally, a person is found who has one blue eye and one brown eye or who has a sector of one…

A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by…

Q: ex. Locate any woodland or forest area close to your home. Create a 10 x 10 m quadrat once you've…

A: We have to complete the task with the help of some techniques. Here some searches are required to…

Q: This Z diagram of the light dependent reaction shows how an electron moves from the reaction center…

A: The "Zscheme" describes the oxidation/reduction changes that occur during photosynthesis's light…

Q: SUBJECT: GENETICS Topic: Binomial Probability Consider albinism a trait to occur in a human…

A: Probability that 2 offspring will be normal is 3/2. Probability that 1 offspring will be albino is…

Q: Mr. Kennedy is a regular coffee drinker. He feels more "alert" after a cup in the morning. This can…

A: The Placebo effect

Q: Discuss the role of phytohormones, fertilizers and pesticides, and genetic engineering in the…

A: Plant Growth and Development means need to  study the control and coordination processes takes place…

Q: MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA…

A: Answer) The correct sequence of base pairs in mRNA would be - 5' AGGCACCAAAUAUGU 3'…

Q: To determine: The reason why most enzymes do not operate at their biochemical optima inside cells.

A: All enzymes share three characteristics. They are distinct in their specificity, regulatory ability,…

Q: advantages of using larger restriction fragments when constructing a genomic library of human DNA

A: DNA library A DNA library is a collection of cloned DNA fragments containing the gene of interest.…

Q: Supposing two strains of autotetraploid plants are available and their genotypes are as follows.…

A: In genetics, the physical appearance of an individual is termed as phenotype whereas the genetic…

Q: Which of the following does NOT pertain to the myoblast-determining gene 1?* a. It is a master gene.…

A: Developmental biology describes how interacting mechanisms generate an organism's various size,…

Q: What are B and T cells and how do they relate to lymph nodes? 2. What are cell-surface antigens? How…

A: Introduction:- The remarkable specificity of adaptive immune responses is due to lymphocytes.…

Q: In onions, male sterility is due to the interaction of a chromosomal allele pair hh and "sterile"…

A: Cytoplasmic inheritance occurs when the DNA from the parents' cytoplasmic organelles is inherited by…

Q: Amari suspects they have a condition called metatarsalgia. This term is related to the term…

A: Introduction Metatarsalgia is a painful and inflammatory condition affecting the ball of your foot.…

Q: A pigment is bright. b. d. absorbs certain wavelengths of light. reflect all energy. absorb all…

A:

Q: Hominins differ from hominids in that they have larger brains. True O False

A: Human evolution is the evolutionary process that led to the formation of Homo sapiens as a unique…

Q: 1. The recipient's of organ transplants can acquire some of the behavior and emotional traits of…

A: Neurons have been discovered in important organs like the heart, kidney, and liver. Transferred…

Q: Three weeks ago, 20-year-old Sacheen came down with symptoms typical of the common cold. She had a…

A: Bronchitis disease and it's effect on patient.

Q: Biology ex. Locate any woodland or forest area close to your home. Create a 10 x 10 m quadrat once…

A: The goal of the research is to achieve the goal through the application of techniques. During the…

Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…

A: Unlike bacterial RNA polymerase, the eukaryotic RNA polymerase cannot initiate transcription in…

Q: 2. Label the muscles on the dorsal and ventral sides of the frog. Write all the answers in the next…

A: Frog contains many muscles on their dorsal and ventral sides. These muscles are needed to perform…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: The Gulf of St. Lawrence is home to the beluga whalesThere once were thousands of belugas in this…

A: Bio accumulation: It is increase of contaminant concentration in aquatic organisms following uptake…

Q: Elucidate the fundamental challenges the aquatic vertebrates and terrestrial vertebrates face in…

A: Terrestrial Vertebrates:  Land-based (land-dwelling) Non-native Vertebrates (animals having a…

Q: Ten glyceraldehyde-3-phosphate (G3P) produced by the Calvin cycle is used to produce a. 5 glucose.…

A: Photosynthesis is a metabolic process in which organic material ( glucose ) is synthesized from…

Q: A male with blood type A and genotype Ii, mates with a female with blood type B and genotype IPi.…

A: The "ABO" blood group system is made up of four blood groups – A, B, AB, and O and is based mostly…

Q: Elaborate on the statement “embryonic development involves both activation and inhibition”. Support…

A: Embryonic development involves both activation and inhibition.

Q: To examine: Whether the given statement, "most of the DNA sequences in a bacterial genome code for…

A: Nucleic acids are heritable genetic material. Nucleic acids are nucleotide polymer. Nucleotides are…

Q: Which of the following would likely t a part of the circulatory system? O pituitary gland O distal…

A: Circulatory syatem also known as blood vascular system is divided into two types:  Open circulatory…

Q: What role do feedback mechanisms play in the regulation of hormone production in mammals? Give two…

A: Regulation of hormone production The control of the production of hormones is vital for the process…

Q: Spongy bone is found: in the periosteum in the ends of long bones O inside lacunae only in the fetal…

A:

Q: DNA polymerase III can correct replication errors through its ________ activity. a. 3’ to 5’…

A: Introduction: Although DNA replication is a highly precise process, errors such as a DNA polymerase…

Q: Which of the following best describes the function of telomerase? a. The telomerase uses its RNA…

A: Which of the following best describes the function of telomerase  Answer :  a. The telomerase uses…

Q: Summarize the bones of the bird skeleton and its structural parts. Table 1. Summary of Avian…

A: Aves Aves is a taxonomic class including birds. Birds evolved from reptiles, as the…

Q: 1. How far should you record and observe any fauna encountered outside the quadrat? Why do you think…

A: Quadrat method The quadrat method is a widely adopted sampling method to estimate the number of…

Q: Humans have employed biotechnology since ancient times to breed animals and improve their crops.…

A: Biotechnology means the branch of science which uses living organisms by combining natural science…

Q: Based on the theory of island biogeography, how would you expect the species richness of birds on…

A: Theory of island biogeography The theory was given by MacArthur and Wilson in 1967. It studies the…

Q: When the sympathetic division of the human nervous system is stimulated, what is the most likely…

A: Sympathetic nervous system The sympathetic nervous system or the SNS is the division of the…

Q: Compare the male and female reproductive organs of reptiles and birds. Explain how are their…

A: Introduction Reptiles are cold-blooded animals that have vertebral columns at their backs. These…

Q: Transcription factors are allowed to enter and exit the nuclease at all times. 1 A▾ B I U S X₂ x² $$…

A: The above statement is true.

Modes of Nutrition

It is a biological process of providing or obtaining food that is necessary for growth and health. It includes many physiological processes - absorption, ingestion, assimilation, catabolism, excretion, etc. In biology, the science that deals with nutrition's physiological and chemical processes are called "nutritional science."