explain the following:P→ Parental generation.G → Gametes.F1→ First filial generation.F2→ Second filial generationGenotype (F2 (Phenotype (F2)I chose Stem length seed shapeRound Wrinkled(RR) (mr)pod shapeseed colorGreen Yellow(5) (8)pod colorInflated constricted Green Yellowflower colorWhite (pp)flower positionPurple (PP)Terminalstem lengthShort

Here the phenotye choosen is stem length. Long stem length is dominant over short stem length. Let L…

Answered: explain the following: P→ Parental…

explain the following: P→ Parental generation. G → Gametes. F1→ First filial generation. F2→ Second filial generation Genotype (F2 ( Phenotype (F2) I chose Stem length

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter27: Reproduction And Development Of Flowering Plants

Section: Chapter Questions

Problem 5SA: Seeds are mature _______ ; fruits are mature_______ . a. ovaries; ovules c. ovules; ovaries b....

See similar textbooks

Related questions

Q: mitosis meiosis prophase prometaphase metaphase anaphase telophase ||| eukaryotic cell division used…

A: Cell division are of two types : mitosis and meiosis. A cell copies all of its components, including…

Q: What is the size range for most typical bacteria? Both of these are correct 200-2000 nanometers x…

A: Introduction : Bacteria belong to a large group of microscopic, unicellular living organisms.…

Q: Diamond Sex-linked Mt-linked Heterosis III E E Standardized symbol in a pedigree chart representing…

A: The passing of genetic information from the parents to the offspring is called inheritance.…

Q: The enzyme amylase will affect the breakdown of carbohydrates, but it will not affect the break-…

A: The body system is the network of organs and tissues that interact and depend on one another to…

Q: A cell undergoing division has a haploid chromosome number of 15. Give the numerical value for each…

A: Meiosis is a type of cell division that is also known as reduction cell division. This because a…

Q: A couple would like to conceive a child. When should timed intercourse occur? O immediately before…

A: The duration of menstrual cycle is about 28 days. In the menstrual cycle, ovulation generally takes…

Q: Average human height has changed over the past few centuries. The current generation's average…

A: INTRODUCTION Phenotypic variation refers to the physical characteristics or traits of an organism,…

Q: Define plaque-forming unit and explain its role in the quantification of viruses

A: INTRODUCTION Plaque-forming is a phenomenon seen in immunology research where antibodies are tested…

Q: Simplify that answer please

A: Introduction COVID-19 (Coronavirus Disease 19) is a highly infectious respiratory illness caused by…

Q: An anticodon is 5' CGA 3. The codon that pairs with the anticodon will be FOOD An anticodon is…

A: Introduction Gene expression is the process by which the information stored in a gene, in the form…

Q: Hydrogen ions are charged. What would need to happen to transport them across a cell membrane, and…

A: The plasma membrane is the dynamic, fluid structure that forms the boundary of the cell. It…

Q: need help understanding how to calculate CFU/mL

A: CFU stands for Colony Forming Unit that is useful for determining the bacterial count in particular…

Q: For each question, choose the cell drawing(s) from those labeled A to P that best meets the listed…

A: During prophase, the mitotic spindle also starts to form. Microtubules gradually build up between…

Q: True False Glochidia morphology (shape) Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia…

A: The history of the events by which species or other taxa have evolved from a common ancestor is…

Q: Having five fingers on each hand is a recessive trait, yet most people in the world are born with…

A: Dominant and recessive traits are terms used in genetics to describe how a trait expresses itself…

Q: For each of the following amino acids: 1) describe what the important functional group of the amino…

A: Proteins are made up of amino acids. Each amino acid has a distinct side chain, also referred to as…

Q: Please explain the process of DNA Replication.

A: INTRODUCTION The process of duplicating the genetic data included in a cell's DNA is known as DNA…

Q: The pedigree below represents an autosomal recessive disease. What characteristic(s) of the pedigree…

A: Pedigree analysis is the study of family patterns of genetic inheritance, particularly with regard…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Q: This is an SDS-PAGE gel of the protein insulin. The first lane is the molecular weight standard…

A: Introduction: Insulin is a hormone produced by the pancreas that regulates glucose metabolism in the…

Q: How are teratogens related to critical periods? Teratogens have varying impacts during different…

A: Tertogen is a chemical substance on whose exposure birth defects are caused in the foetus. These…

Q: TING not randomly 75% randomly 1:1 50% Mendel was able to derive the law of segregation by his study…

A: According to Mendel's law of segregation, Each gene separates from the others during gamete…

Q: 37. Which of the following motifs can be used to bind protein dimers? a.) helix-loop-helix b.) zinc…

A: Motif is nothing but a short conserved sequence pattern, which is associated with protein function…

Q: Explain 1 way each of the following can occur. In your answer, say whether non- disjunction occurs…

A: Introduction : When sister chromatids or homologous chromosomes fail to correctly separate during…

Q: 1. Can you think of anything that would prevent meiosis from occurring in an organism with one set…

A: Introduction Chromosomes are long, coiled structures that are composed of DNA and proteins and are…

Q: Basic body color for horses is influenced by several genes, one of which has several different…

A: It is a question related to the incomplete dominance which are heterozygous conditions are shows.

Q: Enzymes that catalyze RNA-directed DNA synthesis are called ______. A(n)__________ is an enzyme that…

A: Introduction : One of the initial steps in gene expression is transcription. The transit of genetic…

Q: Enzyme ptyalin pepsin trypsin small intestine Location mouth stomach Temperature (°C) 36.7-37.0…

A: The digestion is a process of breaking down the complex food components into the smaller components.…

Q: 1) Dr. Thompson is hoping to produce a tester outcome from her cross. Which of the following would…

A: There are two genes present in this inheritance. These are M and N genes. Each gene has two alleles.…

Q: Using your knowledge of lipid structure and properties and any other scientifically reliable online…

A: Introduction :- HDL, or high-density lipoprotein, is a type of cholesterol that is often referred to…

Q: Aunt Smiley has the cutest pointed ears (Pp) and would love to have all her children with pointed…

A: Introduction :- Genetics plays a crucial role in determining the characteristics of an offspring.…

Q: List and explain four ways in which Environmental DNA has changed the field of conservation biology.…

A: Introduction : Environmental DNA is DNA that has been extracted from environmental materials and…

Q: Many biochemical reactions are non-spontaneous but are required for living organisms. How can they…

A: Chemical processes known as "biochemical reactions" happen within the cells of living beings. The…

Q: Butterfly wings and bat wings are ____ structures, while bird wings and bat wings are ____…

A: In biology, homology refers to the similarity of the arrangement, physiology, or growth of different…

Q: In humans, the alleles for blood type are designated IA (A-type blood), IB (B-type blood) and i…

A: The inheritance of blood types in humans is determined by alleles. Different combinations of alleles…

Q: The cells of sexual reproduction genes chromosomes gametes zygotes are called

A: Sexual reproduction is the process of creating new organisms by combining the genetic information of…

Q: Give answer to all parts only written answer

A: Introduction: A blood group, also known as a blood type, is a classification system used to identify…

Q: 1) Which statement below about asexual reproduction is FALSE? a) With asexual reproduction,…

A: Introduction : Reproduction is a process by which one organism produces offsprings. There are two…

Q: 30. Which of the following statements are correct regarding a nucleosome? a.) contains an octamer…

A: Introduction A nucleosome is the basic unit of DNA packaging in eukaryotic cells. It is composed of…

Q: What biomolecule are promoters and enhancers composed of?

A: Biomolecules are organic compounds present inside the cells of the living organism. Protein, lipids,…

Q: D Question 9 Which of these are not a criterion for being a neurotransmitter? O It must be readily…

A: Introduction : Neurotransmitters are the substances that are released from the neuron terminal to…

Q: Q.A protein has two domains, which are labeled with two probes for energy transfer. Calculate the…

A: Introduction Energy transfer is a process by which energy is transferred from one molecule to…

Q: Each statement in the five numbers below describes a situation in which a person makes use of the…

A: In a scientific setting, a hypothesis is a testable claim about the relationship between two or more…

Q: How does someone develop an allergy to an antibiotic such as penicillin?

A: Antibiotic penicillin works well to treat bacterial infections. A material known as peptidoglycan…

Q: Somatostatin

A: Introduction A hormone is a chemical messenger produced by glands in the endocrine system that…

Q: What is the function of a promoter in gene expression?

A: Transcription is the process through which ribonucleic acid (RNA) is synthesised from DNA. The term…

Q: Considering that Noor and Hamza do produce a first child and name her Roop, what is the likelihood…

A: PKU (Phenylketonuria) is an inherited disorder caused by a lack of the enzyme phenylalanine…

Q: A. Draw. Use the information shown below to construct a cladogram for some of the organisms.

A: Introduction :- A cladogram is a diagram used in evolutionary biology to represent the evolutionary…

Q: Imagine this scenario: In E.coli the Operon X encodes for Proteins Y, X and Z. Proteins Y, X and Z…

A: Introduction The lac operon is a group of genes in bacteria that are regulated as a unit and are…

Q: It has been a really bad day at the hospital. The maternity ward staff has mixed up four female…

A: There are mainly four types of blood groups which A,B,AB and O based on the presence of antigens and…

Question

explain the following:
P→ Parental generation.
G → Gametes.
F1→ First filial generation.
F2→ Second filial generation
Genotype (F2 (
Phenotype (F2)

I chose Stem length

seed shape
Round Wrinkled
(RR) (mr)
pod shape
seed color
Green Yellow
(5) (8)
pod color
Inflated constricted Green Yellow
flower color
White (pp)
flower position
Purple (PP)
Terminal
stem length
Short

Definition Definition Observable physical traits or characteristics of an organism, which are determined by its genetic makeup (genotype) as well as environmental factors. These traits can include anything from eye color or height to behavior or disease susceptibility. Understanding an organism's phenotype is important in fields such as genetics, medicine, and ecology.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Theare collectively called the calyx sepals petals tepals stamens
After double fertilization: a zygote and ______ form. an ovule endosperm a cotyledon asuspensor
The pollen lands on which part of the flower? stigma style ovule integument
In flowers, the structures that produce male gametophytes are called _______ ;the strcutures that produce female gametophytes are called _______ . a. pollen grains; flowers c. anthers; stigma b. stamen; carpels d. megaspores; microspores
Figure 26.15 If a flower lacked a megasporangium, what type of gamete would not form? If the flower lacked a microsporangium, what type of gamete would not form?
In flowrers, the structures that produce male gametophytes are called ______; the structures that produce female gametophytes are called _______. a. carpels; stamens b. pollen grains; flowers c. anthers; carpels d. megaspores; microspores
Seeds are mature _______ ; fruits are mature_______ . a. ovaries; ovules c. ovules; ovaries b. ovules; stamens d. stamens; ovaries
The stamen consists of a long stalk called the filament that supports the. stigma sepal style anther
In plants that lack endosperm in their mature seeds, the cotyledons function to (a) enclose and protect the seed (b) aid in seed dispersal (c) serve as an absorptive embryonic root (d) store food reserves (e) attach the embryo within the ovule
Match the terms with the most suitable description. ____ ovule a. pollen tube together with its contents ____ receptacle b. consists of seven cells, one with two nuclei ____ double fertilization c. after fertilization, develops into a seed ____ anther d. embryonic shoot ____ plumule e. pollen sacs inside ____ mature female gametophyte f. swollen stem; base of flower ____ mature male gametophyte g. formation of zygote and first cell of endosperm
20 Identify the flower type based on corolla. (2 Points) rotate bilabiate campanulate papilionaceous spurred Let's keep you up on desktop notifica T ligulate Turn on Don 11: 30°C Partly sunny 2/
Flower No.of No of of Stigma No. Ovary superior Complete Flaral Monocot Name sepals petals anthers, Free or (S) or inferior or symmetry or dicot Fused, Fused, color fused or incomplete flower separate, separate, color intermediate flower color (IM) 1. Lily 2. 3.