From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…
A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…
Q: Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular…
A: Answer - This tRNA would carry the amino acid Serine to the ribosome. mRNA carries codon. tRNA…
Q: Which of the following statements are true? O Each stop codon also codes for an amino acid O Each…
A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…
Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…
A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…
Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…
Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…
A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…
Q: Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of…
A: Any detectable, inheritable qualitative or quantitative change in genetic material of an organism…
Q: TRANSLATE this RNA sequence: AUGCAAUGA Met-Gin-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop What…
A: As you have posted multiple questions, we are supposed to answer only first 3 subparts. Kindly…
Q: Using a table that shows which codon represents which amino acid determine the following: A)…
A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…
Q: What do you have a nucleotide triplet codes for codon for UGU ? Identify a base pair substitution…
A: The DNA nucleotide triplet codes for RNA triplet codon which further codes for specific amino acid.…
Q: DNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding…
A: The mRNA is produced by the process of transcription. And protein is produced by the process of…
Q: In this sequence there are two introns and three exons. Exon 1 has 3 amino acids, exon 2 has 4 amino…
A: Once a gene is transcribed into a pre-mRNA transcript containing both coding (called as exons)…
Q: If the DNA molecule read its complementary strand as: TACGATCCGAACCAAACT, how would the m-RNA read…
A: The given DNA template is TACGATCCGAACCAAACT The mRNA template would be AUGCUAGGCUUGGUUUGA When…
Q: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…
A: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…
Q: The figure below shows a ribosome in the process of translating an mRNA with the sequence:…
A: Codon refers to a sequence of three nucleotides, which codes for start signal, stop signal for…
Q: Degeneracy of Genetic Code * ( Choose True if the statement is correct abourt and Degeneracy of…
A: Codon is the set of three nucleotide that encode an amino acid.
Q: DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and…
A: Codon is a base triplet that exists in DNA. DNA gets transcripted to mRNA which then translates to…
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Add an A before codon 3 or delete the middle base in…
A: A frameshift mutation occurs in the DNA sequence due to either addition or deletion of DNA bases…
Q: The figure below shows a ribosome in the process of translating an mRNA with the sequence:…
A: The wobble hypothesis is tells that a single tRNA can recognize more than one codon. This is occurs…
Q: Noncoding Strand -> 5’ - G C C A G G T C A G G T - 3’…
A: The terms used in the question represents the molecules involved in gene expression. A gene is a…
Q: 1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ mRNA: polypeptide chain:
A: (According to our regulations, we are required to answer only the first question in case of multiple…
Q: Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info…
A: Central dogma of molecular biology: It states that the DNA which contains the genes are…
Q: Which of the following most accurately describes the anticodon? A. Contains a sequence…
A: Anticodon The base sequence of tRNA which pairs with codon of mRNA during translation is called…
Q: Transcribe the following DNA sequence into codons.…
A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…
Q: Some tRNAs can recognize more than one codon because there is a relaxation of the complementation…
A: Translation of mRNA into protein requires a specialized adapter molecule called tRNA and ribosomes.…
Q: Draw the molecular structure of a looped RNA with 10 nucleotides, from 3' to 5': AUCGUCGGAU, show…
A: A DNA strand is made up of three parts: Nitrogenous Bases Deoxyribose Sugar Phosphate group They…
Q: Let’s suppose a researcher mixed together nucleotides with the following percentage of bases: 30% G,…
A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…
Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T…
A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not…
Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…
A: When there is an error in the DNA sequence during replication it causes a change in the DNA…
Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…
A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…
Q: The nucleotide triplet AAA is the codon for Lysine. This codon originated from the following piece…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: Look at the codon "UUU" in the codon chart. If the 3rd nucleotide (3rd Uracil) was mutated to a "C"…
A: The genetic code is triplet code called codon.The genetic code is degenerate meaning that given…
Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…
A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…
Q: Describe the effect of this mutation on the amino acid sequence of the beta-gloving polypeptide…
A: Point mutation It refers to the mutation in which the single-nucleotide of the sequence of DNA…
Q: Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code…
A: Note - We answer one question at a time. The set of rules through which information in the DNA or…
Q: The figure below shows a ribosome in the process of translating an mRNA with a sequence:…
A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…
Q: The peptide bond formation a. occurs when two tRNAs are located inside the P and A site in the…
A: Given: The peptide bond formation.
Q: Second base of codon C A UUU Phenylalanine UCU UAU UGU Cysteine U Tyrosine tyr y U UUC phe F UCC…
A: The process of protein synthesis is called translation. messenger RNA, transfer RNA and ribosomes…
Q: Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde /…
A: The order of nucleotides in the nucleic acid is referred to as nucleic acid sequence. The process of…
Q: Use the following sense DNA sequence 5'- ATGTCCTGGTAA-3' to answer the following questions below.…
A: A) The resulting polypeptide from the mutated DNA sequence is- 5'-ATGTCCTGGTAA-3' Sense DNA…
Q: Codons The genetic code consists of triplets of nucleotides called codons. Refer to the genetic…
A: Cells are the building blocks of life. They are the constituent structural and functional units of…
Q: Which of these single strand RNA sequences could form a hairpin secondary structure? 5'…
A: The RNA is usually a single stranded molecule of nucleic acid. In RNA four types of nitrogenous…
Q: You are studying two mRNA sequences. The nucleotides in the first sequence are in the correct order:…
A: As per the 1st sequence of bases given, the amino acids present would be- Gly-Arg-Cys After the…
Q: The genetic information contained in DNA consists of a linear sequence of coding units known as…
A: From the given case, it is known that the E. coli DNA has a size of 4.70 X 106 bps. As, it is given…
Q: 1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction…
A: In a transcription unit; the there are 2 DNA strands. The strand with polarity 3' to 5' is the…
Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives…
A: The mRNA codon chart is used to find the amino acid with respect to the particular codon.
Q: Determine the sequence of amino acids specified by the codons in the following information strand.…
A:
Q: The Wobble Hypothesis proposed by Francis Crick postulates that... OA. Base pairing between…
A: Wooble hypothesis was proposed by crisck and he explained degeneracy of genetic code. This…
- From the given DNA base sequence indicated below:
5’’AGCCCATATGGCCCATACGCGGAATCGC 3’
- Give the codon sequence and anticodon that will interact from the codon sequence
- Write the amino acids produced from the codon sequence.
Step by step
Solved in 2 steps
- Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
- Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…Provide the DNA sequencce (not RNA sequence) for the Start Codon and 3 Stop Codons.Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
- Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.1e) Give the sequence of every codon this tRNA, with the anticodon 5'AGG3', could base pair with (perfect and wobble matches), and name the amino acid coded for by each codon whose sequence you have written.
- Table 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids A UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser UA tyr tyr term ala alanine term val valine UG cys cys term trp ile isoleucine leu leucine CU leu leu leu leu ser serine CC pro pro pro pro threonine proline aspartate glutamate lysine arginine thr CA his his gin gin pro asp glu lys CG arg arg arg arg AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gin AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu GG gly gly gly gly term termination 3. Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space provided. If the letters code for more than one amino acid, separate the names by dashes. b. UUA: c. GAG: d. UAUCUA: e. AUCUUG: f. AAGAGUUCG: g. AAAUUUGGG: h.…Consider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence 2: GCG GAG AAA UGG UAU Draw an anti-parallel b-sheet that can be formed between the amino acids from the two codon sequences.Determine the sequence of amino acids specified by the codons in the following information strand. AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА Then determine the sequence of amino acids if an insertion occurred to the left of the first adenosine and changed the reading frame as shown below. Notice that (1) the insertion is shown on the left by the lower-case “i", and (2) the bases are still in the same sequence; they are just shifted so that they are read differently. IAG GTC TTC AGG GAA TGC СTG GCG AGA GGG GAG CAG СTG GTA TCG CTG GGC CCA Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC CAA This is the strand with the SNP. (The change is shown in red.) AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TAG TAT CGC TGG GCC САА Suppose a different single-nucleotide…
